Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI20758
Trapped Gene
1700001L05Rik (ENSMUSG00000075511)
Vector Insertion
Chr 15: 83189381 - 83194249
Public Clones not available
Private Clones OST352941 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000647305 (Chr15:83194250..83194358 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CATCAGTTGCTTGGAGTCACA Chr15:83194273..83194293 59.89 47.62 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000647305 (Chr15:83194250..83194358 -)
Downstram Exon
ENSMUSE00000647304 (Chr15:83187990..83189380 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CATCAGTTGCTTGGAGTCACA Chr15:83194273..83194293 59.89 47.62 TTATGTCCTGGCCCTACCTG Chr15:83189092..83189111 59.95 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000647307 Chr15:83197420..83197707 GGTTGGTCAACGGTCGTATT Chr15:83197467..83197486 59.72 50
upstream ENSMUSE00000647306 Chr15:83195459..83195940 GGAATGGGGTACCAGTGATG Chr15:83195731..83195750 60.05 55
upstream ENSMUSE00000647305 Chr15:83194250..83194358 CATCAGTTGCTTGGAGTCACA Chr15:83194273..83194293 59.89 47.62

*** Putative Vector Insertion (Chr 15: 83189381 - 83194249) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000647304 Chr15:83187990..83189380 TTATGTCCTGGCCCTACCTG Chr15:83189092..83189111 59.95 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAGAGCAGGTCTGTGGGTTT Chr15:83191219..83191239 60.3 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCTTTTTCGTGACTGGGAAA Chr15:83191185..83191205 60.23 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000075511