Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI20785
Trapped Gene
D8Ertd738e (ENSMUSG00000019362)
Vector Insertion
Chr 8: 86770593 - 86773372
Public Clones IST10080D5 (tigm)
Private Clones OST352295 (lexicon) OST340695 (lexicon) OST340639 (lexicon) OST311986 (lexicon)
OST307263 (lexicon) OST277123 (lexicon) OST217570 (lexicon) OST83516 (lexicon)
OST27884 (lexicon) OST7938 (lexicon)
Severity of mutation (?) Insertion after 52% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000212098 (Chr8:86773373..86773428 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000212098 (Chr8:86773373..86773428 -)
Downstram Exon
ENSMUSE00000336410 (Chr8:86770136..86770592 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000338228 Chr8:86773515..86773618 No primer for this exon
upstream ENSMUSE00000212098 Chr8:86773373..86773428 No primer for this exon

*** Putative Vector Insertion (Chr 8: 86770593 - 86773372) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000336410 Chr8:86770136..86770592 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAGTAATCGCCTTGCAGCAC Chr8:86773304..86773324 60.94 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTGAGTGAAGCGATGCAAGT Chr8:86773351..86773371 59.04 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CGTTGTTCAGCAGCAGAAGT Chr8:86773379..86773399 59.24 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CGTTGTTCAGCAGCAGAAGT Chr8:86773379..86773399 59.24 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000019362