Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI20795
Trapped Gene
Arhgef1 (ENSMUSG00000040940)
Vector Insertion
Chr 7: 25693444 - 25697075
Public Clones not available
Private Clones OST352102 (lexicon)
Severity of mutation (?) Insertion after 8% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000316790 (Chr7:25693330..25693443 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCCAGTTCCAGAGCCTAGAG Chr7:25693349..25693368 59.19 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000316790 (Chr7:25693330..25693443 +)
Downstram Exon
ENSMUSE00000316781 (Chr7:25697076..25697174 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCCAGTTCCAGAGCCTAGAG Chr7:25693349..25693368 59.19 60 AAGGCCTTCTTGGCTTCTTT Chr7:25697140..25697159 59.48 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000711973 Chr7:25687931..25688147 No primer for this exon
upstream ENSMUSE00000676693 Chr7:25688056..25688147 No primer for this exon
upstream ENSMUSE00000676703 Chr7:25689424..25689516 CTTCTCTTCCCATCCGACAG Chr7:25689497..25689516 59.8 55
upstream ENSMUSE00000716760 Chr7:25689426..25689516 CTTCTCTTCCCATCCGACAG Chr7:25689497..25689516 59.8 55
upstream ENSMUSE00000535991 Chr7:25692735..25692776 TCCTGGAGATGGGAGAAGTC Chr7:25692745..25692764 59.18 55
upstream ENSMUSE00000713033 Chr7:25692735..25692776 TCCTGGAGATGGGAGAAGTC Chr7:25692745..25692764 59.18 55
upstream ENSMUSE00000316794 Chr7:25692873..25692953 GATTTTGAGAACGAGCTGGAG Chr7:25692930..25692950 59.07 47.62
upstream ENSMUSE00000316790 Chr7:25693330..25693443 GCCAGTTCCAGAGCCTAGAG Chr7:25693349..25693368 59.19 60

*** Putative Vector Insertion (Chr 7: 25693444 - 25697075) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000316781 Chr7:25697076..25697174 AAGGCCTTCTTGGCTTCTTT Chr7:25697140..25697159 59.48 45
downstream ENSMUSE00000316777 Chr7:25697329..25697371 No primer for this exon
downstream ENSMUSE00000316770 Chr7:25697574..25697820 TATGAACCGCCTCTGGACAT Chr7:25697626..25697645 60.48 50
downstream ENSMUSE00000316763 Chr7:25698159..25698188 No primer for this exon
downstream ENSMUSE00000316759 Chr7:25698418..25698517 TCTTGTCCCCACTCTTGGTC Chr7:25698491..25698510 60.09 55
downstream ENSMUSE00000316751 Chr7:25698639..25698735 GTTCGTCTGACCTCCGATTC Chr7:25698669..25698688 59.66 55
downstream ENSMUSE00000316744 Chr7:25701037..25701072 No primer for this exon
downstream ENSMUSE00000316738 Chr7:25701820..25701960 TGTCCCGAGAAGACATACCC Chr7:25701879..25701898 59.93 55
downstream ENSMUSE00000636501 Chr7:25701823..25701960 TGTCCCGAGAAGACATACCC Chr7:25701879..25701898 59.93 55
downstream ENSMUSE00000316731 Chr7:25702914..25703019 CTCAGTCTCGCCATTGTCCT Chr7:25703020..25703039 60.41 55
downstream ENSMUSE00000636500 Chr7:25703539..25703550 No primer for this exon
downstream ENSMUSE00000636499 Chr7:25704203..25704370 No primer for this exon
downstream ENSMUSE00000316725 Chr7:25704650..25704795 CCCAGGAGGTTCTTCTGGTT Chr7:25704722..25704741 60.48 55
downstream ENSMUSE00000316718 Chr7:25706890..25707036 GTCATGCAGTACCCGTAGCA Chr7:25706945..25706964 59.75 55
downstream ENSMUSE00000316709 Chr7:25707344..25707426 ATCAAGCGATCGAGGAACAG Chr7:25707368..25707387 60.36 50
downstream ENSMUSE00000316700 Chr7:25707560..25707685 No primer for this exon
downstream ENSMUSE00000316692 Chr7:25707826..25707940 AGCAGCAGTGGGTACTTGGT Chr7:25707920..25707939 59.79 55
downstream ENSMUSE00000316681 Chr7:25708029..25708129 TCCACTTTCCCTCGTTCTGT Chr7:25708059..25708078 59.7 50
downstream ENSMUSE00000316670 Chr7:25708383..25708460 GCCGTAGGTGAGTCAAGTCC Chr7:25708431..25708450 59.73 60
downstream ENSMUSE00000316663 Chr7:25708678..25708753 No primer for this exon
downstream ENSMUSE00000316655 Chr7:25708822..25708989 No primer for this exon
downstream ENSMUSE00000316647 Chr7:25709815..25709902 TTTTTGCGTTCCGAAGATGT Chr7:25709905..25709924 60.62 40
downstream ENSMUSE00000316638 Chr7:25709995..25710081 TTCAGGGATCCAGCAGTCTC Chr7:25710036..25710055 60.35 55
downstream ENSMUSE00000316630 Chr7:25710271..25710338 CATCAGCTGGAGCCATCTCT Chr7:25710341..25710360 60.52 55
downstream ENSMUSE00000316622 Chr7:25710420..25710506 CAGAAGGGCAGGAGGTCATT Chr7:25710462..25710481 61.55 55
downstream ENSMUSE00000316615 Chr7:25710803..25710966 AGTTGTCTGATGGCCACCTC Chr7:25710965..25710984 60.12 55
downstream ENSMUSE00000354389 Chr7:25711043..25711142 GGGGTCTTAGGCGACAAAAT Chr7:25711079..25711098 60.32 50
downstream ENSMUSE00000676689 Chr7:25711043..25711142 GGGGTCTTAGGCGACAAAAT Chr7:25711079..25711098 60.32 50
downstream ENSMUSE00000676687 Chr7:25711259..25711604 GTTCAGCCAATCTCCCTCTG Chr7:25711376..25711395 59.8 55
downstream ENSMUSE00000676692 Chr7:25711259..25711604 GTTCAGCCAATCTCCCTCTG Chr7:25711376..25711395 59.8 55
downstream ENSMUSE00000720406 Chr7:25711259..25711611 GTTCAGCCAATCTCCCTCTG Chr7:25711376..25711395 59.8 55
downstream ENSMUSE00000676694 Chr7:25711329..25711371 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGAGGCTGGGCAACTAAGAT Chr7:25693476..25693496 59.84 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGAGGCTGGGCAACTAAGAC Chr7:25693476..25693496 60.4 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000040940