Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI20796
Trapped Gene
Arl10 (ENSMUSG00000025870)
Vector Insertion
Chr 13: 54676639 - 54677110
Public Clones IST14521D1 (tigm)
Private Clones OST352072 (lexicon) OST232693 (lexicon)
Severity of mutation (?) Insertion after 25% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000153730 (Chr13:54676426..54676638 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCTGGGCTCTGTGCTCTTTA Chr13:54676512..54676531 60.68 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000153730 (Chr13:54676426..54676638 +)
Downstram Exon
ENSMUSE00000153728 (Chr13:54677111..54677309 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCTGGGCTCTGTGCTCTTTA Chr13:54676512..54676531 60.68 55 GGTCCACCTCGAAATTCTTG Chr13:54677303..54677322 59.53 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000153730 Chr13:54676426..54676638 GCTGGGCTCTGTGCTCTTTA Chr13:54676512..54676531 60.68 55

*** Putative Vector Insertion (Chr 13: 54676639 - 54677110) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000153728 Chr13:54677111..54677309 GGTCCACCTCGAAATTCTTG Chr13:54677303..54677322 59.53 50
downstream ENSMUSE00000153731 Chr13:54680154..54680329 CTTAGCCGGTCAGTCGAGTC Chr13:54680250..54680269 60.01 60
downstream ENSMUSE00000153729 Chr13:54682082..54682489 AACAACAATGCGGAAGAAGG Chr13:54682324..54682343 60.11 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTCCCTCAGTGGGACGAGTG Chr13:54676616..54676636 63.24 65 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTCCCTCAGTGGGACGAGTG Chr13:54676616..54676636 63.24 65 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000025870