Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI20798
Trapped Gene
Gabbr1 (ENSMUSG00000024462)
Vector Insertion
Chr 17: 37183235 - 37183639
Public Clones not available
Private Clones OST351937 (lexicon) OST102170 (lexicon) OST78459 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000696575 (Chr17:37183016..37183234 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGCCTGGATTCCTGTGGAAG Chr17:37183105..37183124 61.55 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000696575 (Chr17:37183016..37183234 +)
Downstram Exon
ENSMUSE00000543755 (Chr17:37183640..37183721 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGCCTGGATTCCTGTGGAAG Chr17:37183105..37183124 61.55 55 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000696575 Chr17:37183016..37183234 AGCCTGGATTCCTGTGGAAG Chr17:37183105..37183124 61.55 55

*** Putative Vector Insertion (Chr 17: 37183235 - 37183639) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000543755 Chr17:37183640..37183721 No primer for this exon
downstream ENSMUSE00000448950 Chr17:37184399..37184602 TGTCCATATCCGTCCAGGAG Chr17:37184590..37184609 60.88 55
downstream ENSMUSE00000503591 Chr17:37185366..37185551 GGCCCTGACTACAGATGCTC Chr17:37185524..37185543 59.83 60
downstream ENSMUSE00000696573 Chr17:37186722..37186742 No primer for this exon
downstream ENSMUSE00000696551 Chr17:37187750..37188104 TAGTCCGGCAGGATGTCTCT Chr17:37188076..37188095 59.83 55
downstream ENSMUSE00000510627 Chr17:37187944..37188104 TAGTCCGGCAGGATGTCTCT Chr17:37188076..37188095 59.83 55
downstream ENSMUSE00000142512 Chr17:37191076..37191210 GATCTTGATGGGGTCGTTGT Chr17:37191141..37191160 59.79 50
downstream ENSMUSE00000142518 Chr17:37191682..37191852 GTCCGAAAGAACGTTGGAAA Chr17:37191749..37191768 60.09 45
downstream ENSMUSE00000142524 Chr17:37192791..37192892 TGATCTCAATCCCAGCCTCT Chr17:37192842..37192861 59.76 50
downstream ENSMUSE00000142505 Chr17:37193241..37193306 AAGTCCCACGATGATTCGAG Chr17:37193273..37193292 60.07 50
downstream ENSMUSE00000142507 Chr17:37193733..37193924 CCCAAAGAGCCGTTCCTTAT Chr17:37193759..37193778 60.44 50
downstream ENSMUSE00000142508 Chr17:37199479..37199721 CTTTTCAGCCGCTTGGTTAG Chr17:37199525..37199544 60.01 50
downstream ENSMUSE00000142525 Chr17:37200275..37200338 GCTGCTCGATAAGCGTCCAT Chr17:37200335..37200354 62.72 55
downstream ENSMUSE00000142511 Chr17:37201605..37201682 ATCATCCTTGGTGCTGTCGT Chr17:37201654..37201673 60.54 50
downstream ENSMUSE00000142515 Chr17:37204159..37204309 GGCTGGAGAGAACTGAGACG Chr17:37204254..37204273 60.13 60
downstream ENSMUSE00000142510 Chr17:37204721..37204853 GACAGCAGCTAGTGCCAGTG Chr17:37204796..37204815 59.8 60
downstream ENSMUSE00000142522 Chr17:37206057..37206173 TAAAGCCTAAGCCCAAGAGC Chr17:37206090..37206109 58.74 50
downstream ENSMUSE00000142517 Chr17:37206258..37206365 GGCCTACAGTGGCGTACAGT Chr17:37206297..37206316 60.2 60
downstream ENSMUSE00000142521 Chr17:37206926..37207019 GGTTCCTCCTTGGCAAAAGT Chr17:37206948..37206967 60.48 50
downstream ENSMUSE00000696549 Chr17:37207165..37207193 TCACAGCAAAAAGACCAAAGC Chr17:37207191..37207211 60.41 42.86
downstream ENSMUSE00000142516 Chr17:37207599..37207726 GCCCTGTGGTCATTGATCTT Chr17:37207701..37207720 59.93 50
downstream ENSMUSE00000142509 Chr17:37208798..37208926 ATGGTGACAGGAGCGGTAAT Chr17:37208832..37208851 59.43 50
downstream ENSMUSE00000142514 Chr17:37209089..37209232 TTTCCAATTCACGGTTTTCC Chr17:37209221..37209240 59.78 40
downstream ENSMUSE00000468594 Chr17:37209798..37210377 TAAGAGGGGGATTGGAGCTT Chr17:37210075..37210094 60.03 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTAATCGCCTTGCAGCACAT Chr17:37183285..37183305 61.69 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GACGTCGTGACTGGGAAAAC Chr17:37183281..37183301 60.56 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024462