Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI20800
Trapped Gene
Tmem79 (ENSMUSG00000001420)
Vector Insertion
Chr 3: 88136576 - 88136813
Public Clones not available
Private Clones OST351915 (lexicon)
Severity of mutation (?) Insertion after 64% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000722006 (Chr3:88136814..88137604 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000722006 (Chr3:88136814..88137604 -)
Downstram Exon
ENSMUSE00000175664 (Chr3:88136362..88136575 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000477203 Chr3:88138304..88138385 No primer for this exon
upstream ENSMUSE00000673604 Chr3:88138304..88138376 No primer for this exon
upstream ENSMUSE00000673608 Chr3:88138030..88138190 No primer for this exon
upstream ENSMUSE00000385570 Chr3:88136814..88137604 No primer for this exon
upstream ENSMUSE00000673602 Chr3:88136814..88137703 No primer for this exon
upstream ENSMUSE00000722006 Chr3:88136814..88137604 No primer for this exon

*** Putative Vector Insertion (Chr 3: 88136576 - 88136813) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000175664 Chr3:88136362..88136575 No primer for this exon
downstream ENSMUSE00000673601 Chr3:88132969..88133854 No primer for this exon
downstream ENSMUSE00000673606 Chr3:88132968..88133854 No primer for this exon
downstream ENSMUSE00000346745 Chr3:88132966..88133854 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCCATCGTACTCGGTGAGTC Chr3:88136805..88136825 60.53 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCCATCGTACTCGGTGAGTC Chr3:88136805..88136825 60.53 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000001420