Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI20803
Trapped Gene
Rab1b (ENSMUSG00000024870)
Vector Insertion
Chr 19: 5105251 - 5106924
Public Clones IST14753B7 (tigm) IST14931E12 (tigm)
Private Clones OST351776 (lexicon) OST191074 (lexicon)
Severity of mutation (?) Insertion after 2% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000145701 (Chr19:5106925..5107019 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGAGTGGCAACCATCTTGGA Chr19:5106994..5107013 63.37 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000145701 (Chr19:5106925..5107019 -)
Downstram Exon
ENSMUSE00000145703 (Chr19:5105178..5105250 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGAGTGGCAACCATCTTGGA Chr19:5106994..5107013 63.37 55 CGGAGTCACCAATCAAAAGC Chr19:5105191..5105210 60.64 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000145701 Chr19:5106925..5107019 GGAGTGGCAACCATCTTGGA Chr19:5106994..5107013 63.37 55

*** Putative Vector Insertion (Chr 19: 5105251 - 5106924) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000145703 Chr19:5105178..5105250 CGGAGTCACCAATCAAAAGC Chr19:5105191..5105210 60.64 50
downstream ENSMUSE00000145700 Chr19:5104833..5104928 ACACCGATGGTGCTGATGTA Chr19:5104866..5104885 59.99 50
downstream ENSMUSE00000145698 Chr19:5104641..5104736 CCGCGATAGTAGCTGGAAGT Chr19:5104659..5104678 59.5 55
downstream ENSMUSE00000553253 Chr19:5100667..5100798 ACGACCTTCTTGGTGGTGAG Chr19:5100664..5100683 60.15 55
downstream ENSMUSE00000379928 Chr19:5099207..5100572 TGCTGTCGATCTTCAGGTTG Chr19:5100391..5100410 59.98 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACCCCGAATAGTGAGTGAGC Chr19:5106913..5106933 59.17 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCAGCCTCGATCCTGTCTAT Chr19:5106874..5106894 59.42 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CTAATCGCCTTGCAGCACAT Chr19:5106950..5106970 61.32 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GGAGTGGCAACCATCTTGGA Chr19:5106992..5107012 63.37 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024870