Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI20807
Trapped Gene
Gtf2f1 (ENSMUSG00000002658)
Vector Insertion
Chr 17: 57147330 - 57149110
Public Clones not available
Private Clones OST351704 (lexicon)
Severity of mutation (?) Insertion after 19% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000657110 (Chr17:57149111..57149183 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000657110 (Chr17:57149111..57149183 -)
Downstram Exon
ENSMUSE00000657109 (Chr17:57147136..57147329 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000505928 Chr17:57150532..57150841 No primer for this exon
upstream ENSMUSE00000657111 Chr17:57150399..57150445 No primer for this exon
upstream ENSMUSE00000657110 Chr17:57149111..57149183 No primer for this exon

*** Putative Vector Insertion (Chr 17: 57147330 - 57149110) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000657109 Chr17:57147136..57147329 No primer for this exon
downstream ENSMUSE00000657108 Chr17:57146409..57146579 No primer for this exon
downstream ENSMUSE00000417463 Chr17:57144856..57144967 No primer for this exon
downstream ENSMUSE00000496736 Chr17:57144783..57144851 No primer for this exon
downstream ENSMUSE00000501927 Chr17:57144783..57144967 No primer for this exon
downstream ENSMUSE00000500083 Chr17:57144089..57144242 No primer for this exon
downstream ENSMUSE00000541333 Chr17:57144089..57144242 No primer for this exon
downstream ENSMUSE00000139846 Chr17:57143934..57143995 No primer for this exon
downstream ENSMUSE00000606631 Chr17:57143934..57143995 No primer for this exon
downstream ENSMUSE00000139852 Chr17:57143732..57143851 No primer for this exon
downstream ENSMUSE00000606630 Chr17:57143732..57143851 No primer for this exon
downstream ENSMUSE00000139854 Chr17:57143545..57143618 No primer for this exon
downstream ENSMUSE00000606629 Chr17:57143545..57143618 No primer for this exon
downstream ENSMUSE00000139847 Chr17:57143338..57143476 No primer for this exon
downstream ENSMUSE00000606628 Chr17:57143338..57143476 No primer for this exon
downstream ENSMUSE00000139857 Chr17:57143144..57143234 No primer for this exon
downstream ENSMUSE00000606627 Chr17:57143144..57143234 No primer for this exon
downstream ENSMUSE00000483281 Chr17:57142828..57143054 No primer for this exon
downstream ENSMUSE00000538820 Chr17:57142828..57143054 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCTAACCCTGGGCTGGTAAT Chr17:57149055..57149075 60.2 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGAACCAGGTAAGTGGGTGAT Chr17:57149096..57149117 60.1 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000002658