Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI20815
Trapped Gene
Eif2a (ENSMUSG00000027810)
Vector Insertion
Chr 3: 58359574 - 58360494
Public Clones 5SE307A09 (ggtc) 3SE307A09 (ggtc) CMHD-GT_475A10-3 (cmhd)
Private Clones OST351470 (lexicon) OST26323 (lexicon)
Severity of mutation (?) Insertion after 93% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000173233 (Chr3:58359457..58359573 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAGAAGTGATGCGGCTCCTA Chr3:58359462..58359481 59.98 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000173233 (Chr3:58359457..58359573 +)
Downstram Exon
ENSMUSE00000173229 (Chr3:58360495..58360560 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAGAAGTGATGCGGCTCCTA Chr3:58359462..58359481 59.98 50 GCCTGCTCTTTTAGCTGCTC Chr3:58360532..58360551 59.5 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000639198 Chr3:58329788..58330008 AACACCGACTCGCAGACTTT Chr3:58329878..58329897 59.91 50
upstream ENSMUSE00000255167 Chr3:58335009..58335078 ATGGACCACCACACTTCACA Chr3:58335039..58335058 59.85 50
upstream ENSMUSE00000255157 Chr3:58341456..58341530 AAGGATGGGACATTGTTTGC Chr3:58341493..58341512 59.8 45
upstream ENSMUSE00000255150 Chr3:58343450..58343568 ACTCCTTCGACCTCCCAAAA Chr3:58343488..58343507 60.99 50
upstream ENSMUSE00000173227 Chr3:58344962..58345061 TGGGACGCCTAACCTACAAC Chr3:58344981..58345000 59.99 55
upstream ENSMUSE00000173230 Chr3:58345556..58345638 AATTATTTGTGCCCGGAATG Chr3:58345580..58345599 59.66 40
upstream ENSMUSE00000173219 Chr3:58348917..58348990 TTATCACCTGGAACCCAACC Chr3:58348964..58348983 59.65 50
upstream ENSMUSE00000173213 Chr3:58349150..58349294 CCCCTCATTTGTTCGACTGT Chr3:58349182..58349201 59.97 50
upstream ENSMUSE00000173215 Chr3:58349422..58349538 CTGCTGTGCTGGTAATAGCC Chr3:58349425..58349444 58.56 55
upstream ENSMUSE00000173228 Chr3:58352315..58352886 CAACGCAGCCTTCTATAGCC Chr3:58352454..58352473 60 55
upstream ENSMUSE00000173231 Chr3:58356491..58356604 GAAGAGGAACCTCCCCAGAA Chr3:58356494..58356513 60.56 55
upstream ENSMUSE00000173233 Chr3:58359457..58359573 AAGAAGTGATGCGGCTCCTA Chr3:58359462..58359481 59.98 50

*** Putative Vector Insertion (Chr 3: 58359574 - 58360494) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000173229 Chr3:58360495..58360560 GCCTGCTCTTTTAGCTGCTC Chr3:58360532..58360551 59.5 55
downstream ENSMUSE00000392131 Chr3:58361043..58361341 ATGGCAATTCCATGAACACC Chr3:58361191..58361210 60.59 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGAGGCTTGAATGAAAAGCA Chr3:58359576..58359596 59.54 40 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGAGGCTTGAATGAAAAGCA Chr3:58359576..58359596 59.54 40 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000027810