Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI20816
Trapped Gene
Wdsof1 (ENSMUSG00000022300)
Vector Insertion
Chr 15: 38961845 - 38969629
Public Clones not available
Private Clones OST351395 (lexicon)
Severity of mutation (?) Insertion after 59% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000125374 (Chr15:38961762..38961844 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGTTGGAACCCTATGGAAGC Chr15:38961792..38961811 59.93 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000125374 (Chr15:38961762..38961844 +)
Downstram Exon
ENSMUSE00000125376 (Chr15:38969630..38969794 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGTTGGAACCCTATGGAAGC Chr15:38961792..38961811 59.93 50 GTGCGCGCATATCAAAAGTA Chr15:38969658..38969677 59.87 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000511786 Chr15:38944478..38944597 ACAACTATGTCCGCGAAACC Chr15:38944559..38944578 60 50
upstream ENSMUSE00000125379 Chr15:38950257..38950456 CCTTTTGAAGTCCCACGAGA Chr15:38950286..38950305 60.22 50
upstream ENSMUSE00000508936 Chr15:38950891..38950998 AATGTGCACTCGCTTTTGTG Chr15:38950962..38950981 59.91 45
upstream ENSMUSE00000125381 Chr15:38954759..38954848 AATGGATGGACCAGGCTATG Chr15:38954791..38954810 59.77 50
upstream ENSMUSE00000515393 Chr15:38955875..38956030 TGCTCAATGAACTGGGGATT Chr15:38955974..38955993 60.46 45
upstream ENSMUSE00000125383 Chr15:38959436..38959513 TATGCGGCAAGCTACTCCTT Chr15:38959486..38959505 60 50
upstream ENSMUSE00000125374 Chr15:38961762..38961844 TGTTGGAACCCTATGGAAGC Chr15:38961792..38961811 59.93 50

*** Putative Vector Insertion (Chr 15: 38961845 - 38969629) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000125376 Chr15:38969630..38969794 GTGCGCGCATATCAAAAGTA Chr15:38969658..38969677 59.87 45
downstream ENSMUSE00000471905 Chr15:38975169..38975304 TTTCCACAGTCGGATGTTCA Chr15:38975280..38975299 60.09 45
downstream ENSMUSE00000230447 Chr15:38976637..38976800 GCGAGCAATCCGTTTTACAT Chr15:38976729..38976748 60.1 45
downstream ENSMUSE00000230440 Chr15:38978219..38978399 AACCGCCACTACGTGTTTCT Chr15:38978300..38978319 59.66 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr15:38967895..38967915 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACAAAAATGGCTCCTTCACG Chr15:38964878..38964898 60.11 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000022300