Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI20829
Trapped Gene
6430514L14Rik (ENSMUSG00000032224)
Vector Insertion
Chr 9: 69973005 - 69973993
Public Clones not available
Private Clones OST350760 (lexicon) OST192314 (lexicon) OST62565 (lexicon)
Severity of mutation (?) Insertion after 1% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000696362 (Chr9:69973994..69974090 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCCAACAGGACACCGTACTT Chr9:69974046..69974065 59.88 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000696362 (Chr9:69973994..69974090 -)
Downstram Exon
ENSMUSE00000532202 (Chr9:69972731..69973004 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCCAACAGGACACCGTACTT Chr9:69974046..69974065 59.88 55 CTGCAAACTGCTGACGATGT Chr9:69972814..69972833 60.06 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000696363 Chr9:69989120..69989364 No primer for this exon
upstream ENSMUSE00000696362 Chr9:69973994..69974090 CCCAACAGGACACCGTACTT Chr9:69974046..69974065 59.88 55

*** Putative Vector Insertion (Chr 9: 69973005 - 69973993) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000532202 Chr9:69972731..69973004 CTGCAAACTGCTGACGATGT Chr9:69972814..69972833 60.06 50
downstream ENSMUSE00000384243 Chr9:69958065..69958183 TGCAACTCTTCCTCGGAGAT Chr9:69958045..69958064 59.95 50
downstream ENSMUSE00000635746 Chr9:69950627..69950756 ACTTATGCTCGGCAGAGAGC Chr9:69950694..69950713 59.75 55
downstream ENSMUSE00000635742 Chr9:69946895..69947001 CAGTTTGGTGCTCTGCTCTG Chr9:69946923..69946942 59.77 55
downstream ENSMUSE00000635741 Chr9:69943858..69943993 GCTCTTCAACGGTGCCTTTA Chr9:69943949..69943968 60.39 50
downstream ENSMUSE00000635739 Chr9:69941298..69941490 AACCTCCGCTTTCATCTCCT Chr9:69941283..69941302 60.21 50
downstream ENSMUSE00000635737 Chr9:69937117..69938698 GCTTAGCCACCATCCCATTA Chr9:69937767..69937786 59.92 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGGTGTGAATAATCGCCTTG Chr9:69973931..69973951 60.33 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCCACGAGGGTTTCTAGAGG Chr9:69973949..69973969 61 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032224