Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI2083
Trapped Gene
Klf3 (ENSMUSG00000029178)
Vector Insertion
Chr 5: 65208070 - 65213112
Public Clones (sanger) XS0187 (sanger) (sanger) (sanger) (sanger) P127H07 (ggtc)
D173D06 (ggtc) P127H07 (ggtc) IST14593A12 (tigm) IST13659E9 (tigm)
Private Clones OST448750 (lexicon) OST424934 (lexicon) OST280469 (lexicon) OST248574 (lexicon)
OST247690 (lexicon) OST240511 (lexicon) OST234028 (lexicon) OST180464 (lexicon)
OST141985 (lexicon) OST40079 (lexicon)
Severity of mutation (?) Insertion after 5% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000186617 (Chr5:65207974..65208069 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATCCAGTCCCTGTCAAGCAG Chr5:65208026..65208045 60.26 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000186617 (Chr5:65207974..65208069 +)
Downstram Exon
ENSMUSE00000186613 (Chr5:65213113..65213596 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATCCAGTCCCTGTCAAGCAG Chr5:65208026..65208045 60.26 55 ATAAAAGGAACGGGCTGGAC Chr5:65213522..65213541 60.32 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000394739 Chr5:65194628..65195030 GTCATGTGACTGCCCAGAGTT Chr5:65194780..65194800 60.17 52.38
upstream ENSMUSE00000186617 Chr5:65207974..65208069 ATCCAGTCCCTGTCAAGCAG Chr5:65208026..65208045 60.26 55

*** Putative Vector Insertion (Chr 5: 65208070 - 65213112) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000186613 Chr5:65213113..65213596 ATAAAAGGAACGGGCTGGAC Chr5:65213522..65213541 60.32 50
downstream ENSMUSE00000186619 Chr5:65214118..65214268 GGGTTCATTAAAGGGGGTGA Chr5:65214241..65214260 60.91 50
downstream ENSMUSE00000186625 Chr5:65218349..65218509 CTGTGTATCCTGCGCTTCCT Chr5:65218438..65218457 60.42 55
downstream ENSMUSE00000186622 Chr5:65220216..65221367 ACCCTCTCGGTATCCAGCTT Chr5:65221268..65221287 60.1 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTTGATCCAGTCCCTGTCAA Chr5:65208023..65208043 59.06 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTGTCGTGACTGGGAAAACC Chr5:65208117..65208137 60.54 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029178