Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI20838
Trapped Gene
Gopc (ENSMUSG00000019861)
Vector Insertion
Chr 10: 52059660 - 52065854
Public Clones not available
Private Clones OST350481 (lexicon)
Severity of mutation (?) Insertion after 91% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000302374 (Chr10:52065855..52066035 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000302374 (Chr10:52065855..52066035 -)
Downstram Exon
ENSMUSE00000302366 (Chr10:52056891..52059659 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000302418 Chr10:52101417..52101881 No primer for this exon
upstream ENSMUSE00000417835 Chr10:52078579..52078743 No primer for this exon
upstream ENSMUSE00000666378 Chr10:52077148..52077171 No primer for this exon
upstream ENSMUSE00000098649 Chr10:52074378..52074553 No primer for this exon
upstream ENSMUSE00000098643 Chr10:52073133..52073298 No primer for this exon
upstream ENSMUSE00000098648 Chr10:52070407..52070502 No primer for this exon
upstream ENSMUSE00000098646 Chr10:52068878..52069042 No primer for this exon
upstream ENSMUSE00000302374 Chr10:52065855..52066035 No primer for this exon

*** Putative Vector Insertion (Chr 10: 52059660 - 52065854) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000302366 Chr10:52056891..52059659 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAAGACAGCAGTGGCGAGAT Chr10:52059867..52059887 60.02 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAAGACAGCAGTGGCGAGAT Chr10:52059867..52059887 60.02 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000019861