Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI20845
Trapped Gene
Hmgb2 (ENSMUSG00000054717)
Vector Insertion
Chr 8: 59992005 - 59992086
Public Clones not available
Private Clones OST350154 (lexicon)
Severity of mutation (?) Insertion after 47% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000458104 (Chr8:59991859..59992004 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAAGAGCGACAAAGCTCGTT Chr8:59991900..59991919 60.71 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000458104 (Chr8:59991859..59992004 +)
Downstram Exon
ENSMUSE00000478008 (Chr8:59992087..59992261 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAAGAGCGACAAAGCTCGTT Chr8:59991900..59991919 60.71 50 TTGATCTTTGGGCGATTTTC Chr8:59992134..59992153 60.02 40

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000458285 Chr8:59990704..59990802 GATTGCGTTAGCGAGAAACC Chr8:59990715..59990734 59.85 50
upstream ENSMUSE00000501473 Chr8:59991372..59991545 CCGAGTTCTCCAAGAAATGC Chr8:59991511..59991530 59.81 50
upstream ENSMUSE00000458104 Chr8:59991859..59992004 CAAGAGCGACAAAGCTCGTT Chr8:59991900..59991919 60.71 50

*** Putative Vector Insertion (Chr 8: 59992005 - 59992086) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000478008 Chr8:59992087..59992261 TTGATCTTTGGGCGATTTTC Chr8:59992134..59992153 60.02 40
downstream ENSMUSE00000595616 Chr8:59992763..59993291 GCCTACCAGGACCCTTCTTT Chr8:59992826..59992845 59.58 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTCCGAAGAGACCACCGTAA Chr8:59991990..59992010 60.25 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTCCGAAGAGACCACCGTAA Chr8:59991990..59992010 60.25 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000054717