Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI20849
Trapped Gene
Alg12 (ENSMUSG00000035845)
Vector Insertion
Chr 15: 88636905 - 88636987
Public Clones not available
Private Clones OST349977 (lexicon) OST54937 (lexicon)
Severity of mutation (?) Insertion after 80% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000312396 (Chr15:88636988..88637151 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGCCACGTCCCTCTATGTGT Chr15:88637054..88637073 59.6 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000312396 (Chr15:88636988..88637151 -)
Downstram Exon
ENSMUSE00000312388 (Chr15:88636829..88636904 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGCCACGTCCCTCTATGTGT Chr15:88637054..88637073 59.6 55 ACCGTGACACTCCTGTCTGG Chr15:88636832..88636851 61.21 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000371786 Chr15:88649688..88649715 No primer for this exon
upstream ENSMUSE00000312430 Chr15:88646497..88646684 CCACCAGCTGGACATAGACA Chr15:88646499..88646518 59.7 55
upstream ENSMUSE00000312421 Chr15:88646288..88646420 CCCGTGGTTTATGTGCTCTC Chr15:88646326..88646345 60.52 55
upstream ENSMUSE00000312413 Chr15:88645724..88645897 GCTGGATATCAGCCACACAG Chr15:88645782..88645801 59.27 55
upstream ENSMUSE00000555071 Chr15:88644884..88645078 CTCAGCCTTCGTCATCATTG Chr15:88645004..88645023 59.39 50
upstream ENSMUSE00000312405 Chr15:88644859..88645078 TTCGTCATCATTGGCTTCAG Chr15:88644997..88645016 59.8 45
upstream ENSMUSE00000555069 Chr15:88642486..88642589 ACGGTTGCTGTGGACTCCTA Chr15:88642565..88642584 60.71 55
upstream ENSMUSE00000555067 Chr15:88641727..88641950 GGACAGGAGGACCTATGCAC Chr15:88641848..88641867 59.53 60
upstream ENSMUSE00000312396 Chr15:88636988..88637151 AGCCACGTCCCTCTATGTGT Chr15:88637054..88637073 59.6 55

*** Putative Vector Insertion (Chr 15: 88636905 - 88636987) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000312388 Chr15:88636829..88636904 ACCGTGACACTCCTGTCTGG Chr15:88636832..88636851 61.21 60
downstream ENSMUSE00000555066 Chr15:88636295..88636484 ATACTGGCCAGGACTCGATG Chr15:88636343..88636362 60.1 55
downstream ENSMUSE00000680042 Chr15:88636269..88636292 GCAGCCGCTCTAGAAGTACC Chr15:88636251..88636270 59.25 60
downstream ENSMUSE00000399686 Chr15:88635676..88636484 TGGTGGTGTGTGTGTGTGTC Chr15:88635792..88635811 59.92 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAAGTGCTCCCTGAGGAAAA Chr15:88636959..88636979 60.37 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAAGTGCTCCCTGAGGAAAA Chr15:88636959..88636979 60.37 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000035845