Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI20857
Trapped Gene
Ppm1g (ENSMUSG00000029147)
Vector Insertion
Chr 5: 31507061 - 31507370
Public Clones not available
Private Clones OST349607 (lexicon)
Severity of mutation (?) Insertion after 59% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000186189 (Chr5:31507371..31507502 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTGAGGAGGCAGAGAACGAG Chr5:31507452..31507471 60.13 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000186189 (Chr5:31507371..31507502 -)
Downstram Exon
ENSMUSE00000186188 (Chr5:31506826..31507060 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTGAGGAGGCAGAGAACGAG Chr5:31507452..31507471 60.13 60 CTCCATTGACTCGTCCATCC Chr5:31506828..31506847 60.47 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000343992 Chr5:31522676..31522918 CATGGGTGCCTACCTCTCTC Chr5:31522777..31522796 59.68 60
upstream ENSMUSE00000186202 Chr5:31510760..31510829 TCCTGAGCTGGACAATGAGA Chr5:31510793..31510812 59.5 50
upstream ENSMUSE00000186193 Chr5:31510386..31510471 TTGCCTTGTACTGTGCCAAA Chr5:31510443..31510462 60.29 45
upstream ENSMUSE00000186190 Chr5:31509936..31510068 GGGAGACCCACTGAAGATGA Chr5:31509971..31509990 60.05 55
upstream ENSMUSE00000186194 Chr5:31508411..31508826 AGCTGCCTCGAGTTGCTAAG Chr5:31508477..31508496 59.92 55
upstream ENSMUSE00000186189 Chr5:31507371..31507502 GTGAGGAGGCAGAGAACGAG Chr5:31507452..31507471 60.13 60

*** Putative Vector Insertion (Chr 5: 31507061 - 31507370) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000186188 Chr5:31506826..31507060 CTCCATTGACTCGTCCATCC Chr5:31506828..31506847 60.47 55
downstream ENSMUSE00000186196 Chr5:31506403..31506532 CAGCACCTTGATGTCAGGAA Chr5:31506431..31506450 59.83 50
downstream ENSMUSE00000269838 Chr5:31505945..31506047 CTACAACCTCCTGGCTGCTC Chr5:31505997..31506016 60.01 60
downstream ENSMUSE00000377771 Chr5:31505043..31505657 TGATGATGCACGTCATGTTG Chr5:31505563..31505582 60.12 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000029147