Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI20869
Trapped Gene
Epb4.9 (ENSMUSG00000022099)
Vector Insertion
Chr 14: 71004856 - 71005103
Public Clones not available
Private Clones OST349361 (lexicon)
Severity of mutation (?) Insertion after 84% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000555954 (Chr14:71005104..71005169 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000555954 (Chr14:71005104..71005169 -)
Downstram Exon
ENSMUSE00000123585 (Chr14:71004775..71004855 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon CCCTTATTGGTCACCACCAG Chr14:71004796..71004815 60.22 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000486499 Chr14:71029824..71029961 TGCTGGGATTGCTAATGTGA Chr14:71029851..71029870 60.22 45
upstream ENSMUSE00000487384 Chr14:71026546..71026675 CCTGGAGAAGCTGCCTCTTA Chr14:71026644..71026663 59.71 55
upstream ENSMUSE00000686201 Chr14:71026546..71026865 CCTGGAGAAGCTGCCTCTTA Chr14:71026644..71026663 59.71 55
upstream ENSMUSE00000488293 Chr14:71018046..71018215 GAGCCTGACGTCTGTCCTCT Chr14:71018112..71018131 59.58 60
upstream ENSMUSE00000260068 Chr14:71017762..71017836 TCAGCTCCTCCAGAGACTCC Chr14:71017792..71017811 59.66 60
upstream ENSMUSE00000123586 Chr14:71017092..71017247 ACATTGAGCGACCTGACCTC Chr14:71017158..71017177 60.27 55
upstream ENSMUSE00000123581 Chr14:71015881..71015925 TGCTCACTGTCACCCAAATC Chr14:71015906..71015925 59.68 50
upstream ENSMUSE00000123588 Chr14:71015421..71015520 AGCCGGACTCTTGGAATCAT Chr14:71015489..71015508 60.99 50
upstream ENSMUSE00000123583 Chr14:71015041..71015097 CCCGGATTCCAACATCTACA Chr14:71015068..71015087 60.71 50
upstream ENSMUSE00000260042 Chr14:71014650..71014802 CGAGGACCTCATCATCGAAT Chr14:71014746..71014765 60.03 50
upstream ENSMUSE00000260038 Chr14:71013103..71013227 GAGGAGATTAAGGCCATCAGG Chr14:71013130..71013150 60.05 52.38
upstream ENSMUSE00000123580 Chr14:71012475..71012580 GGAGGAAAACACGCTCTCTG Chr14:71012500..71012519 59.99 55
upstream ENSMUSE00000260028 Chr14:71005701..71005765 TGCATTCGGGAACATCTAAA Chr14:71005743..71005762 59.11 40
upstream ENSMUSE00000555961 Chr14:71005500..71005548 GTCCACAGAATTCAGCCCATC Chr14:71005523..71005543 61.82 52.38
upstream ENSMUSE00000647515 Chr14:71005348..71005355 No primer for this exon
upstream ENSMUSE00000555954 Chr14:71005104..71005169 No primer for this exon

*** Putative Vector Insertion (Chr 14: 71004856 - 71005103) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000123585 Chr14:71004775..71004855 CCCTTATTGGTCACCACCAG Chr14:71004796..71004815 60.22 55
downstream ENSMUSE00000555964 Chr14:71003480..71004661 GGACCCAGTGCAACCTTTTA Chr14:71003460..71003479 59.97 50
downstream ENSMUSE00000647502 Chr14:71001070..71004661 GGACCCAGTGCAACCTTTTA Chr14:71003460..71003479 59.97 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTAATCGCCTTGCAGCACAT Chr14:71005033..71005053 61.2 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTGTGTGCTGGAGCAGAAGGT Chr14:71005100..71005121 62.94 57.14 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000022099