Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI20879
Trapped Gene
D19Wsu162e (ENSMUSG00000047731)
Vector Insertion
Chr 19: 46719058 - 46726963
Public Clones not available
Private Clones OST349086 (lexicon)
Severity of mutation (?) Insertion after 12% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000706656 (Chr19:46718843..46719057 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGTGACACAGGACACTGCTG Chr19:46718885..46718904 59.45 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000706656 (Chr19:46718843..46719057 +)
Downstram Exon
ENSMUSE00000472696 (Chr19:46726964..46727125 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGTGACACAGGACACTGCTG Chr19:46718885..46718904 59.45 55 AAACGGCAACGCTGAGTAGT Chr19:46727121..46727140 59.94 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000708213 Chr19:46673627..46673783 GGGAAGAAGAGAGGGAGGAG Chr19:46673630..46673649 59.37 60
upstream ENSMUSE00000713184 Chr19:46673627..46673783 GGGAAGAAGAGAGGGAGGAG Chr19:46673630..46673649 59.37 60
upstream ENSMUSE00000641158 Chr19:46681202..46681249 GTGCGCTTGAGAAGTCAGAA Chr19:46681202..46681221 59.32 50
upstream ENSMUSE00000689283 Chr19:46698043..46698069 CTTTCCTCTGGGGGCTTAGA Chr19:46698047..46698066 60.69 55
upstream ENSMUSE00000471790 Chr19:46718843..46718945 TGTGACACAGGACACTGCTG Chr19:46718885..46718904 59.45 55
upstream ENSMUSE00000706656 Chr19:46718843..46719057 TGTGACACAGGACACTGCTG Chr19:46718885..46718904 59.45 55

*** Putative Vector Insertion (Chr 19: 46719058 - 46726963) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000472696 Chr19:46726964..46727125 AAACGGCAACGCTGAGTAGT Chr19:46727121..46727140 59.94 50
downstream ENSMUSE00000389933 Chr19:46728455..46731875 CTGCAAATCTGACCGTAGCA Chr19:46731686..46731705 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGATAATCGCCTTGCAGCAC Chr19:46722106..46722126 60.38 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTCTTGGGGACAGTGTTGGT Chr19:46725041..46725061 60 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000047731