Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI20884
Trapped Gene
Nono (ENSMUSG00000031311)
Vector Insertion
Chr X: 98641568 - 98642932
Public Clones PST21077-NR (escells) PST22466-NR (escells)
Private Clones OST348981 (lexicon) OST264561 (lexicon)
Severity of mutation (?) Insertion after 91% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000549043 (ChrX:98641458..98641567 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAGATGGAACCCTTGGATTG ChrX:98641548..98641567 60.31 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000549043 (ChrX:98641458..98641567 +)
Downstram Exon
ENSMUSE00000372980 (ChrX:98642933..98643929 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAGATGGAACCCTTGGATTG ChrX:98641548..98641567 60.31 50 GGCCAAAACGTTCAGTTGTT ChrX:98642963..98642982 60.01 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000406395 ChrX:98625028..98625101 CCCATACTCCGAGCAAAGAA ChrX:98625069..98625088 60.21 50
upstream ENSMUSE00000208224 ChrX:98625832..98625891 GACTGCGAGGCAGACACTTT ChrX:98625849..98625868 60.6 55
upstream ENSMUSE00000208229 ChrX:98632548..98632716 AGGAAGCATCATCAGCATCA ChrX:98632605..98632624 59.35 45
upstream ENSMUSE00000208220 ChrX:98634826..98635019 GCTTTGGCTTTATTCGCTTG ChrX:98635000..98635019 59.99 45
upstream ENSMUSE00000287293 ChrX:98636855..98637156 ATTGTGGATGACCGAGGAAG ChrX:98637044..98637063 59.93 50
upstream ENSMUSE00000549050 ChrX:98638269..98638364 TGTGGAGCCTATGGACCAGT ChrX:98638287..98638306 60.53 55
upstream ENSMUSE00000549049 ChrX:98638634..98638830 TCAAGTGGATCGGAACATCA ChrX:98638736..98638755 60.05 45
upstream ENSMUSE00000549048 ChrX:98639616..98639700 GGAGGAGCTGCATAACCAAG ChrX:98639650..98639669 59.84 55
upstream ENSMUSE00000549046 ChrX:98640027..98640129 AGGAAGGATTCAAGGGAACC ChrX:98640098..98640117 59.37 50
upstream ENSMUSE00000549044 ChrX:98640634..98640673 No primer for this exon
upstream ENSMUSE00000549043 ChrX:98641458..98641567 CAGATGGAACCCTTGGATTG ChrX:98641548..98641567 60.31 50

*** Putative Vector Insertion (Chr X: 98641568 - 98642932) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000372980 ChrX:98642933..98643929 GGCCAAAACGTTCAGTTGTT ChrX:98642963..98642982 60.01 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCAGGACCTGCCACTATGAT ChrX:98641527..98641547 59.95 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCAGGACCTGCCACTATGAT ChrX:98641527..98641547 59.95 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031311