Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI20901
Trapped Gene
Rapgef1 (ENSMUSG00000039844)
Vector Insertion
Chr 2: 29554516 - 29554606
Public Clones not available
Private Clones OST348737 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000646265 (Chr2:29554517..29554605 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000646265 (Chr2:29554517..29554605 +)
Downstram Exon
ENSMUSE00000697053 (Chr2:29554517..29554605 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon CCCCTGCTTCTCAATGGTTA Chr2:29554552..29554571 60.07 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000718661 Chr2:29475240..29475583 No primer for this exon
upstream ENSMUSE00000720890 Chr2:29475240..29475583 No primer for this exon
upstream ENSMUSE00000646269 Chr2:29534653..29534789 CACCATCCAAGAAGGGAAAG Chr2:29534728..29534747 59.52 50
upstream ENSMUSE00000697060 Chr2:29534653..29534789 CACCATCCAAGAAGGGAAAG Chr2:29534728..29534747 59.52 50
upstream ENSMUSE00000646268 Chr2:29535257..29535370 ACCCTATCCCCTTGGATCTG Chr2:29535288..29535307 60.15 55
upstream ENSMUSE00000697059 Chr2:29535257..29535370 ACCCTATCCCCTTGGATCTG Chr2:29535288..29535307 60.15 55
upstream ENSMUSE00000646267 Chr2:29541625..29541803 TCTTACCCCTGGTGCAGACT Chr2:29541764..29541783 59.72 55
upstream ENSMUSE00000697057 Chr2:29541625..29541803 TCTTACCCCTGGTGCAGACT Chr2:29541764..29541783 59.72 55
upstream ENSMUSE00000646266 Chr2:29544627..29544783 GAAGGGCGTTATCAAAGCTG Chr2:29544747..29544766 59.85 50
upstream ENSMUSE00000697055 Chr2:29544627..29544783 GAAGGGCGTTATCAAAGCTG Chr2:29544747..29544766 59.85 50

*** Putative Vector Insertion (Chr 2: 29554516 - 29554606) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000646265 Chr2:29554517..29554605 CCCCTGCTTCTCAATGGTTA Chr2:29554552..29554571 60.07 50
downstream ENSMUSE00000697053 Chr2:29554517..29554605 CCCCTGCTTCTCAATGGTTA Chr2:29554552..29554571 60.07 50
downstream ENSMUSE00000646264 Chr2:29555206..29555358 GGAGTCTGGGAGCAGTTCAG Chr2:29555299..29555318 59.99 60
downstream ENSMUSE00000697048 Chr2:29555206..29555358 GGAGTCTGGGAGCAGTTCAG Chr2:29555299..29555318 59.99 60
downstream ENSMUSE00000646263 Chr2:29555706..29555826 CACTGGTAGCCCGACTCATT Chr2:29555797..29555816 60.13 55
downstream ENSMUSE00000697045 Chr2:29555706..29555826 CACTGGTAGCCCGACTCATT Chr2:29555797..29555816 60.13 55
downstream ENSMUSE00000646262 Chr2:29556188..29556371 CACAGCTTGTGTTCCGTGAG Chr2:29556365..29556384 60.5 55
downstream ENSMUSE00000646261 Chr2:29557713..29558198 GAGGAGGTGGCTTCTCTGTG Chr2:29558177..29558196 59.99 60
downstream ENSMUSE00000646260 Chr2:29562718..29562920 CTGCGGTGTCTGGTAGAACA Chr2:29562791..29562810 59.9 55
downstream ENSMUSE00000604614 Chr2:29565673..29565828 GGCCACTTTAGTTTGCTGGA Chr2:29565738..29565757 60.25 50
downstream ENSMUSE00000568277 Chr2:29565676..29565828 GGCCACTTTAGTTTGCTGGA Chr2:29565738..29565757 60.25 50
downstream ENSMUSE00000604613 Chr2:29575113..29575370 GTGGTGAGGCATGAAGTCCT Chr2:29575163..29575182 60.12 55
downstream ENSMUSE00000646241 Chr2:29576163..29576258 TGACATACTCATCCCCACCA Chr2:29576211..29576230 59.76 50
downstream ENSMUSE00000646257 Chr2:29577744..29577829 TCCCCATTTTCTCTGCTGTC Chr2:29577829..29577848 60.19 50
downstream ENSMUSE00000646256 Chr2:29580293..29580404 AGTGTCAGCCTGGCCATAAT Chr2:29580397..29580416 59.58 50
downstream ENSMUSE00000646254 Chr2:29581726..29581801 TGAACCACCACGAACATCTG Chr2:29581761..29581780 60.57 50
downstream ENSMUSE00000289495 Chr2:29586048..29586136 GGGCTGATGAAGGTCCTGTA Chr2:29586105..29586124 60.07 55
downstream ENSMUSE00000662872 Chr2:29586048..29586132 GGGCTGATGAAGGTCCTGTA Chr2:29586105..29586124 60.07 55
downstream ENSMUSE00000662871 Chr2:29588347..29588439 CACTCGAACCAGCACAAAGA Chr2:29588428..29588447 60.03 50
downstream ENSMUSE00000337094 Chr2:29588351..29588439 CACTCGAACCAGCACAAAGA Chr2:29588428..29588447 60.03 50
downstream ENSMUSE00000646251 Chr2:29589097..29589282 TCTTCTGGTCCACCTTGTCC Chr2:29589227..29589246 60.09 55
downstream ENSMUSE00000646250 Chr2:29589720..29589804 ATCTCGTGGCTGTGGAAATC Chr2:29589758..29589777 60.08 50
downstream ENSMUSE00000646248 Chr2:29589945..29590039 TGGGTCAGATTGGGACTCTT Chr2:29590009..29590028 59.51 50
downstream ENSMUSE00000646247 Chr2:29591322..29591400 GAACTTGAGGAGCAGCCTCT Chr2:29591388..29591407 58.77 55
downstream ENSMUSE00000646246 Chr2:29591504..29591605 GATGGCCAGGTAGGAGTTGA Chr2:29591548..29591567 60.07 55
downstream ENSMUSE00000646245 Chr2:29592092..29592189 GTAGGCTCGGAAGGAGGATG Chr2:29592148..29592167 61.12 60
downstream ENSMUSE00000646243 Chr2:29592847..29592975 GAACGAAGGTCAGGTCTTGC Chr2:29592881..29592900 59.85 55
downstream ENSMUSE00000332648 Chr2:29593440..29595883 TTCTCTTCGCGGTCTGTTTT Chr2:29593586..29593605 59.99 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAACAACGTGACTGGGAAAA Chr2:29554561..29554581 59.58 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000039844