Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI2091
Trapped Gene
Vps53 (ENSMUSG00000017288)
Vector Insertion
Chr 11: 75915591 - 75927442
Public Clones XR0372 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 45% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000676678 (Chr11:75927443..75927584 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000676678 (Chr11:75927443..75927584 -)
Downstram Exon
ENSMUSE00000676677 (Chr11:75915489..75915590 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000368369 Chr11:75992915..75993132 No primer for this exon
upstream ENSMUSE00000296424 Chr11:75988129..75988209 No primer for this exon
upstream ENSMUSE00000296417 Chr11:75979701..75979750 No primer for this exon
upstream ENSMUSE00000296410 Chr11:75977300..75977366 No primer for this exon
upstream ENSMUSE00000587742 Chr11:75968411..75968470 No primer for this exon
upstream ENSMUSE00000296402 Chr11:75951810..75951896 No primer for this exon
upstream ENSMUSE00000296394 Chr11:75949701..75949816 No primer for this exon
upstream ENSMUSE00000713777 Chr11:75947911..75948030 No primer for this exon
upstream ENSMUSE00000720700 Chr11:75947911..75948030 No primer for this exon
upstream ENSMUSE00000296376 Chr11:75935020..75935098 No primer for this exon
upstream ENSMUSE00000587740 Chr11:75935020..75935098 No primer for this exon
upstream ENSMUSE00000296368 Chr11:75931164..75931307 No primer for this exon
upstream ENSMUSE00000676680 Chr11:75931164..75931307 No primer for this exon
upstream ENSMUSE00000296360 Chr11:75930561..75930703 No primer for this exon
upstream ENSMUSE00000676679 Chr11:75930561..75930703 No primer for this exon
upstream ENSMUSE00000296350 Chr11:75927443..75927584 No primer for this exon
upstream ENSMUSE00000676678 Chr11:75927443..75927584 No primer for this exon

*** Putative Vector Insertion (Chr 11: 75915591 - 75927442) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000296340 Chr11:75915489..75915590 No primer for this exon
downstream ENSMUSE00000676677 Chr11:75915489..75915590 No primer for this exon
downstream ENSMUSE00000296330 Chr11:75905723..75905817 No primer for this exon
downstream ENSMUSE00000676676 Chr11:75905723..75905817 No primer for this exon
downstream ENSMUSE00000110383 Chr11:75895944..75896186 No primer for this exon
downstream ENSMUSE00000676675 Chr11:75895944..75896186 No primer for this exon
downstream ENSMUSE00000110382 Chr11:75894649..75894796 No primer for this exon
downstream ENSMUSE00000676674 Chr11:75894649..75894796 No primer for this exon
downstream ENSMUSE00000110380 Chr11:75890542..75890624 No primer for this exon
downstream ENSMUSE00000676673 Chr11:75890542..75890624 No primer for this exon
downstream ENSMUSE00000110379 Chr11:75889937..75890015 No primer for this exon
downstream ENSMUSE00000676672 Chr11:75889937..75890015 No primer for this exon
downstream ENSMUSE00000296284 Chr11:75880243..75880391 No primer for this exon
downstream ENSMUSE00000676670 Chr11:75880243..75880391 No primer for this exon
downstream ENSMUSE00000110386 Chr11:75876487..75876556 No primer for this exon
downstream ENSMUSE00000676669 Chr11:75876487..75876556 No primer for this exon
downstream ENSMUSE00000110384 Chr11:75861942..75862079 No primer for this exon
downstream ENSMUSE00000676668 Chr11:75861942..75862079 No primer for this exon
downstream ENSMUSE00000110385 Chr11:75860567..75860671 No primer for this exon
downstream ENSMUSE00000676667 Chr11:75860567..75860671 No primer for this exon
downstream ENSMUSE00000394302 Chr11:75859728..75860084 No primer for this exon
downstream ENSMUSE00000676666 Chr11:75859728..75860084 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGCAGACTGAGAGCAGAGCA Chr11:75921415..75921435 59.18 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGCAGACTGAGAGCAGAGCA Chr11:75921415..75921435 59.18 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000017288