Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI20915
Trapped Gene
Ccdc77 (ENSMUSG00000030177)
Vector Insertion
Chr 6: 120304018 - 120304073
Public Clones not available
Private Clones OST348382 (lexicon) OST329405 (lexicon) OST279426 (lexicon) OST41544 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000721759 (Chr6:120304019..120304072 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCATGAACTTCACTCCGACA Chr6:120304039..120304058 59.84 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000721759 (Chr6:120304019..120304072 -)
Downstram Exon
ENSMUSE00000290655 (Chr6:120304019..120304072 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCATGAACTTCACTCCGACA Chr6:120304039..120304058 59.84 50 GTCCGTGTCGGAGTGAAGTT Chr6:120304012..120304031 60.16 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000290661 Chr6:120307345..120307369 No primer for this exon
upstream ENSMUSE00000692801 Chr6:120307345..120307490 CGTGAGCGATTGGTAGGATT Chr6:120307411..120307430 60.1 50
upstream ENSMUSE00000290655 Chr6:120304019..120304072 GCATGAACTTCACTCCGACA Chr6:120304039..120304058 59.84 50
upstream ENSMUSE00000721759 Chr6:120304019..120304072 GCATGAACTTCACTCCGACA Chr6:120304039..120304058 59.84 50

*** Putative Vector Insertion (Chr 6: 120304018 - 120304073) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000196098 Chr6:120300225..120300462 GGTATCACCAAAGCCAGAGC Chr6:120300392..120300411 59.7 55
downstream ENSMUSE00000692800 Chr6:120300225..120300408 CTGCTCTTCGCAAGCTTCTC Chr6:120300203..120300222 60.56 55
downstream ENSMUSE00000196111 Chr6:120298406..120298548 CTGCTGCAAGTTCCACTCAA Chr6:120298500..120298519 60.17 50
downstream ENSMUSE00000196100 Chr6:120291991..120292087 GGGGAGGCTCCTTATGAAAA Chr6:120291974..120291993 60.39 50
downstream ENSMUSE00000196108 Chr6:120289153..120289216 CTTTGGAAGCAGAAGGCTCA Chr6:120289134..120289153 60.65 50
downstream ENSMUSE00000196106 Chr6:120288087..120288178 TCAGAAATGCCCTCCTTGTC Chr6:120288102..120288121 60.19 50
downstream ENSMUSE00000196104 Chr6:120284787..120284935 TCTCTGGTGCTGAACTTGGA Chr6:120284797..120284816 59.54 50
downstream ENSMUSE00000196102 Chr6:120281830..120282049 GAAAGTCCTTGGTGCTCTCG Chr6:120281981..120282000 59.99 55
downstream ENSMUSE00000196109 Chr6:120279352..120279477 CTCCCGAATTCGAGCAAGTT Chr6:120279360..120279379 61.63 50
downstream ENSMUSE00000196094 Chr6:120279112..120279264 GCCTGATAGCGCTTTGTCAT Chr6:120279187..120279206 60.38 50
downstream ENSMUSE00000347606 Chr6:120275193..120275511 CCCTGAAAGGAGTCATCAGC Chr6:120275325..120275344 59.8 55
downstream ENSMUSE00000649287 Chr6:120275053..120275511 CCCTGAAAGGAGTCATCAGC Chr6:120275325..120275344 59.8 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000030177