Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI20944
Trapped Gene
Mmrn2 (ENSMUSG00000041445)
Vector Insertion
Chr 14: 35212810 - 35216098
Public Clones not available
Private Clones OST347689 (lexicon)
Severity of mutation (?) Insertion after 87% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000365657 (Chr14:35211016..35212809 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAGTGGCTAGGGCTGACTTC Chr14:35211199..35211218 60.01 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000365657 (Chr14:35211016..35212809 +)
Downstram Exon
ENSMUSE00000689733 (Chr14:35216099..35217473 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAGTGGCTAGGGCTGACTTC Chr14:35211199..35211218 60.01 60 GTTTCCAACCACAAGGGAGA Chr14:35216808..35216827 59.94 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000561719 Chr14:35188690..35188964 CATTTCGCTTGAAGACCACA Chr14:35188722..35188741 59.84 45
upstream ENSMUSE00000221942 Chr14:35209351..35209479 ATTCCTGGTCCATTCACAGC Chr14:35209414..35209433 59.93 50
upstream ENSMUSE00000221934 Chr14:35209558..35209664 GTACCAGGTCCAGCAGAAGG Chr14:35209582..35209601 59.72 60
upstream ENSMUSE00000221927 Chr14:35209745..35209825 GACTTGGGACTCGATGGATG Chr14:35209794..35209813 60.47 55
upstream ENSMUSE00000413364 Chr14:35210733..35210906 AGATGGCTTTCCAGGCTCTT Chr14:35210827..35210846 60.35 50
upstream ENSMUSE00000365657 Chr14:35211016..35212809 CAGTGGCTAGGGCTGACTTC Chr14:35211199..35211218 60.01 60

*** Putative Vector Insertion (Chr 14: 35212810 - 35216098) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000689733 Chr14:35216099..35217473 GTTTCCAACCACAAGGGAGA Chr14:35216808..35216827 59.94 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACTATCCCTGGCAGGTAGCA Chr14:35212763..35212783 59.72 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACTATCCCTGGCAGGTAGCA Chr14:35212763..35212783 59.72 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000041445