Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI20969
Trapped Gene
Mobkl1a (ENSMUSG00000006262)
Vector Insertion
Chr 5: 89170184 - 89172328
Public Clones not available
Private Clones OST347115 (lexicon) OST243128 (lexicon) OST172939 (lexicon)
Severity of mutation (?) Insertion after 2% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000652266 (Chr5:89170173..89170183 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000652266 (Chr5:89170173..89170183 +)
Downstram Exon
ENSMUSE00000188229 (Chr5:89172329..89172495 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000694846 Chr5:89149880..89150146 No primer for this exon
upstream ENSMUSE00000694841 Chr5:89149896..89150146 No primer for this exon
upstream ENSMUSE00000652266 Chr5:89170173..89170183 No primer for this exon

*** Putative Vector Insertion (Chr 5: 89170184 - 89172328) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000188229 Chr5:89172329..89172495 No primer for this exon
downstream ENSMUSE00000188227 Chr5:89174067..89174175 No primer for this exon
downstream ENSMUSE00000694840 Chr5:89174082..89174175 No primer for this exon
downstream ENSMUSE00000416791 Chr5:89178550..89178683 No primer for this exon
downstream ENSMUSE00000416787 Chr5:89182185..89182348 No primer for this exon
downstream ENSMUSE00000416802 Chr5:89185120..89187014 No primer for this exon
downstream ENSMUSE00000694830 Chr5:89185120..89187480 No primer for this exon
downstream ENSMUSE00000694842 Chr5:89185120..89191083 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr5:89170235..89170255 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000006262