Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI20972
Trapped Gene
Tead3 (ENSMUSG00000002249)
Vector Insertion
Chr 17: 28478293 - 28478546
Public Clones not available
Private Clones OST346970 (lexicon) OST175817 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000610126 (Chr17:28478294..28478545 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000610126 (Chr17:28478294..28478545 -)
Downstram Exon
ENSMUSE00000203026 (Chr17:28478294..28478545 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000710901 Chr17:28487513..28487545 No primer for this exon
upstream ENSMUSE00000721187 Chr17:28487513..28487545 No primer for this exon
upstream ENSMUSE00000203026 Chr17:28478294..28478545 No primer for this exon
upstream ENSMUSE00000610126 Chr17:28478294..28478545 No primer for this exon

*** Putative Vector Insertion (Chr 17: 28478293 - 28478546) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000549465 Chr17:28477099..28477163 No primer for this exon
downstream ENSMUSE00000139928 Chr17:28473456..28473518 No primer for this exon
downstream ENSMUSE00000657895 Chr17:28473219..28473281 No primer for this exon
downstream ENSMUSE00000657894 Chr17:28472430..28472441 No primer for this exon
downstream ENSMUSE00000139915 Chr17:28471844..28471981 No primer for this exon
downstream ENSMUSE00000139921 Chr17:28471649..28471698 No primer for this exon
downstream ENSMUSE00000139925 Chr17:28471329..28471390 No primer for this exon
downstream ENSMUSE00000242098 Chr17:28470736..28470881 No primer for this exon
downstream ENSMUSE00000610128 Chr17:28470451..28470624 No primer for this exon
downstream ENSMUSE00000139916 Chr17:28470137..28470277 No primer for this exon
downstream ENSMUSE00000610127 Chr17:28469896..28470048 No primer for this exon
downstream ENSMUSE00000497522 Chr17:28468620..28469778 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTTGGCATCTGCTTGTCTAGG Chr17:28478543..28478564 60.02 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000002249