Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI20973
Trapped Gene
Chchd10 (ENSMUSG00000049422)
Vector Insertion
Chr 10: 75398750 - 75398982
Public Clones not available
Private Clones OST346939 (lexicon)
Severity of mutation (?) Insertion after 10% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000451333 (Chr10:75398638..75398749 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCTACGGTCCACGCTTCTTA Chr10:75398660..75398679 60.41 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000451333 (Chr10:75398638..75398749 +)
Downstram Exon
ENSMUSE00000390495 (Chr10:75398983..75399190 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCTACGGTCCACGCTTCTTA Chr10:75398660..75398679 60.41 55 TACCCATGACATGCCCTACA Chr10:75399131..75399150 59.8 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000451333 Chr10:75398638..75398749 GCTACGGTCCACGCTTCTTA Chr10:75398660..75398679 60.41 55

*** Putative Vector Insertion (Chr 10: 75398750 - 75398982) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000390495 Chr10:75398983..75399190 TACCCATGACATGCCCTACA Chr10:75399131..75399150 59.8 50
downstream ENSMUSE00000350915 Chr10:75400052..75400199 GGTTAGGTCGCTCTGAGTGG Chr10:75400153..75400172 59.87 60
downstream ENSMUSE00000451326 Chr10:75400320..75400489 CTCCCAGTCACATGGAACCT Chr10:75400419..75400438 59.96 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAAACGTGTAATCGCCTTGC Chr10:75398793..75398813 60.65 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGGTGAGAGAGAGAGCGACAG Chr10:75398749..75398770 58.94 57.14 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000049422