Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI20977
Trapped Gene
Pcmt1 (ENSMUSG00000019795)
Vector Insertion
Chr 10: 7360614 - 7364122
Public Clones not available
Private Clones OST346879 (lexicon) OST224875 (lexicon)
Severity of mutation (?) Insertion after 44% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000644987 (Chr10:7364123..7364227 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000644987 (Chr10:7364123..7364227 -)
Downstram Exon
ENSMUSE00000644986 (Chr10:7360493..7360613 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000616530 Chr10:7382873..7383048 No primer for this exon
upstream ENSMUSE00000323238 Chr10:7368849..7368953 No primer for this exon
upstream ENSMUSE00000644988 Chr10:7367388..7367419 No primer for this exon
upstream ENSMUSE00000644987 Chr10:7364123..7364227 No primer for this exon

*** Putative Vector Insertion (Chr 10: 7360614 - 7364122) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000644986 Chr10:7360493..7360613 No primer for this exon
downstream ENSMUSE00000644985 Chr10:7359843..7359928 No primer for this exon
downstream ENSMUSE00000666804 Chr10:7357848..7358023 No primer for this exon
downstream ENSMUSE00000355412 Chr10:7357807..7358023 No primer for this exon
downstream ENSMUSE00000666802 Chr10:7357741..7357744 No primer for this exon
downstream ENSMUSE00000616525 Chr10:7349986..7350774 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTGTTTTGCACGGATGGTAA Chr10:7364117..7364137 59.58 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTGTTTTGCACGGATGGTAA Chr10:7364117..7364137 59.58 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000019795