Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI20980
Trapped Gene
Zfp105 (ENSMUSG00000057895)
Vector Insertion
Chr 9: 122832337 - 122834125
Public Clones (sanger)
Private Clones OST346798 (lexicon) OST91564 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000433003 (Chr9:122832196..122832336 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GACTGTTCTCCACCGACCAT Chr9:122832303..122832322 59.97 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000433003 (Chr9:122832196..122832336 +)
Downstram Exon
ENSMUSE00000352918 (Chr9:122834126..122834414 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GACTGTTCTCCACCGACCAT Chr9:122832303..122832322 59.97 55 AACATCGGTCAAGCTCCATC Chr9:122834185..122834204 60.08 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000433003 Chr9:122832196..122832336 GACTGTTCTCCACCGACCAT Chr9:122832303..122832322 59.97 55

*** Putative Vector Insertion (Chr 9: 122832337 - 122834125) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000352918 Chr9:122834126..122834414 AACATCGGTCAAGCTCCATC Chr9:122834185..122834204 60.08 50
downstream ENSMUSE00000220628 Chr9:122835428..122835572 CCAACGAGTAGCTCCCAAAG Chr9:122835518..122835537 59.87 55
downstream ENSMUSE00000495902 Chr9:122838718..122840146 AGGTTGGAGCTTCGAGTGAA Chr9:122839423..122839442 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GACTGTTCTCCACCGACCATC Chr9:122832304..122832325 61.9 57.14 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000057895