Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI20983
Trapped Gene
Bmf (ENSMUSG00000040093)
Vector Insertion
Chr 2: 118372749 - 118373106
Public Clones not available
Private Clones OST346655 (lexicon) OST170228 (lexicon) OST60836 (lexicon)
Severity of mutation (?) Insertion after 31% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000685699 (Chr2:118373107..118373116 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000685699 (Chr2:118373107..118373116 -)
Downstram Exon
ENSMUSE00000562711 (Chr2:118372452..118372748 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon AAGCTGGACTGAGGGTCTGA Chr2:118372493..118372512 59.99 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000458932 Chr2:118375276..118375398 CGGGCGTATTTTGGAAACAA Chr2:118375369..118375388 62.92 45
upstream ENSMUSE00000458923 Chr2:118374777..118374906 CTGAGACGCTGTCCTGGAGT Chr2:118374784..118374803 60.61 60
upstream ENSMUSE00000685699 Chr2:118373107..118373116 No primer for this exon

*** Putative Vector Insertion (Chr 2: 118372749 - 118373106) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000562711 Chr2:118372452..118372748 AAGCTGGACTGAGGGTCTGA Chr2:118372493..118372512 59.99 55
downstream ENSMUSE00000294035 Chr2:118370818..118370981 CGTATGAAGCCGATGGAACT Chr2:118370802..118370821 60.1 50
downstream ENSMUSE00000562709 Chr2:118354496..118358395 GACTGGCTACTTGGCTCCAG Chr2:118357606..118357625 60.01 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAAATCCTTAATCGCCTTGC Chr2:118373043..118373063 59.68 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000040093