Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI20989
Trapped Gene
Blvrb (ENSMUSG00000040466)
Vector Insertion
Chr 7: 28247715 - 28250738
Public Clones IST13973D3 (tigm)
Private Clones OST346449 (lexicon)
Severity of mutation (?) Insertion after 79% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000306742 (Chr7:28247586..28247714 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCTGAAATACGTGGCAGTGA Chr7:28247680..28247699 59.87 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000306742 (Chr7:28247586..28247714 +)
Downstram Exon
ENSMUSE00000676413 (Chr7:28250739..28251003 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCTGAAATACGTGGCAGTGA Chr7:28247680..28247699 59.87 50 TCCCCACCTAGGTCAGAGTG Chr7:28250919..28250938 60.1 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000466644 Chr7:28233051..28233215 TCCTCGGAGTTCTCAGCTTT Chr7:28233096..28233115 59.16 50
upstream ENSMUSE00000676431 Chr7:28233077..28233215 TCCTCGGAGTTCTCAGCTTT Chr7:28233096..28233115 59.16 50
upstream ENSMUSE00000676420 Chr7:28237437..28237569 ATGAGAAGCGGCTGTCTAGC Chr7:28237486..28237505 59.75 55
upstream ENSMUSE00000306762 Chr7:28244275..28244439 GTTATGAGGTGACGGTGCTG Chr7:28244275..28244294 59.17 55
upstream ENSMUSE00000676418 Chr7:28244275..28244439 GTTATGAGGTGACGGTGCTG Chr7:28244275..28244294 59.17 55
upstream ENSMUSE00000676425 Chr7:28244275..28244652 CACTGGCAACGACCTCAGTA Chr7:28244423..28244442 59.9 55
upstream ENSMUSE00000306752 Chr7:28244582..28244671 AACATCGTGACAGCCATGAA Chr7:28244614..28244633 60.12 45
upstream ENSMUSE00000676415 Chr7:28244582..28244671 AACATCGTGACAGCCATGAA Chr7:28244614..28244633 60.12 45
upstream ENSMUSE00000306742 Chr7:28247586..28247714 GCTGAAATACGTGGCAGTGA Chr7:28247680..28247699 59.87 50

*** Putative Vector Insertion (Chr 7: 28247715 - 28250738) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000363036 Chr7:28250739..28251004 TCCCCACCTAGGTCAGAGTG Chr7:28250919..28250938 60.1 60
downstream ENSMUSE00000676413 Chr7:28250739..28251003 TCCCCACCTAGGTCAGAGTG Chr7:28250919..28250938 60.1 60
downstream ENSMUSE00000676423 Chr7:28250739..28251017 TCCCCACCTAGGTCAGAGTG Chr7:28250919..28250938 60.1 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATGGCTGGTTCATTCATTCC Chr7:28250701..28250721 59.76 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATGGCTGGTTCATTCATTCC Chr7:28250701..28250721 59.76 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000040466