Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI20992
Trapped Gene
Parp4 (ENSMUSG00000054509)
Vector Insertion
Chr 14: 57194568 - 57202995
Public Clones not available
Private Clones OST346404 (lexicon) OST312907 (lexicon) OST246201 (lexicon) OST217685 (lexicon)
OST170288 (lexicon) OST136023 (lexicon)
Severity of mutation (?) Insertion after 1% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000558619 (Chr14:57194494..57194567 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000558619 (Chr14:57194494..57194567 +)
Downstram Exon
ENSMUSE00000558618 (Chr14:57202996..57203128 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon AAGGAAAACTTTCCGCCATT Chr14:57203115..57203134 59.94 40

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000558619 Chr14:57194494..57194567 No primer for this exon

*** Putative Vector Insertion (Chr 14: 57194568 - 57202995) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000558618 Chr14:57202996..57203128 AAGGAAAACTTTCCGCCATT Chr14:57203115..57203134 59.94 40
downstream ENSMUSE00000558617 Chr14:57204394..57204589 CTGCACATCGTTCTTTTGGA Chr14:57204474..57204493 59.84 45
downstream ENSMUSE00000558616 Chr14:57206586..57206649 TCCTTCTCTGGGGTGTTGTC Chr14:57206634..57206653 60.09 55
downstream ENSMUSE00000558615 Chr14:57207256..57207331 No primer for this exon
downstream ENSMUSE00000558614 Chr14:57208716..57208817 TATCACAAAGGGGCAGCTCT Chr14:57208790..57208809 59.84 50
downstream ENSMUSE00000558613 Chr14:57209201..57209350 TTCGGCCGTAAAGTGTTCTT Chr14:57209320..57209339 59.75 45
downstream ENSMUSE00000558612 Chr14:57211128..57211265 GCGCCTGAACTAATGACCTC Chr14:57211162..57211181 59.84 55
downstream ENSMUSE00000558611 Chr14:57212061..57212234 GGCGAGTCTCCATTCTTCAG Chr14:57212125..57212144 59.95 55
downstream ENSMUSE00000558610 Chr14:57214091..57214251 AAAGCACGGTATTTGGCAAG Chr14:57214173..57214192 60.13 45
downstream ENSMUSE00000558609 Chr14:57216413..57216550 GAATGTTCCGCACAGGAGAT Chr14:57216537..57216556 60.08 50
downstream ENSMUSE00000558608 Chr14:57217169..57217264 No primer for this exon
downstream ENSMUSE00000558607 Chr14:57221101..57221284 CCATGCACACTGTCATAGCC Chr14:57221250..57221269 60.14 55
downstream ENSMUSE00000558606 Chr14:57221588..57221744 TGATCTCCAGGAGTGCAAAA Chr14:57221667..57221686 59.37 45
downstream ENSMUSE00000429880 Chr14:57226259..57226383 AGAGGAACAGGATTCGCAGA Chr14:57226340..57226359 59.95 50
downstream ENSMUSE00000429864 Chr14:57227198..57227329 ATAGGCACGTGGCTTTGATT Chr14:57227244..57227263 59.6 45
downstream ENSMUSE00000429860 Chr14:57229591..57229677 ACAGCCTCTCGGTACTCCTG Chr14:57229637..57229656 59.47 60
downstream ENSMUSE00000429852 Chr14:57232491..57232655 CTCATTCAACGCCTTGTCCT Chr14:57232649..57232668 60.26 50
downstream ENSMUSE00000429847 Chr14:57233237..57233283 TTTGCTCTGCTCCAATTTCC Chr14:57233285..57233304 60.33 45
downstream ENSMUSE00000429841 Chr14:57233524..57233602 TGGACATAGCCAGGGAGAAG Chr14:57233546..57233565 60.21 55
downstream ENSMUSE00000429835 Chr14:57235169..57235306 TATGCATCACGCAAACCAAT Chr14:57235263..57235282 59.96 40
downstream ENSMUSE00000429829 Chr14:57239291..57239486 AAGCTCCGGTTGAAAGACAA Chr14:57239323..57239342 59.85 45
downstream ENSMUSE00000429822 Chr14:57241021..57241088 GGCCATTTTACTGTCCGTGA Chr14:57241076..57241095 60.89 50
downstream ENSMUSE00000429814 Chr14:57242854..57243041 CTGGAGGTGCCCATCAGATA Chr14:57242973..57242992 61.03 55
downstream ENSMUSE00000429808 Chr14:57246227..57246326 GATGTGACGATTTGCTGTGG Chr14:57246251..57246270 60.12 50
downstream ENSMUSE00000429800 Chr14:57247911..57248081 TGAAGCCGTAGACCAGGAGT Chr14:57248067..57248086 59.87 55
downstream ENSMUSE00000558605 Chr14:57248304..57248384 TCTTGGATGAATGCTTGCAG Chr14:57248332..57248351 59.95 45
downstream ENSMUSE00000429793 Chr14:57253049..57253129 TTTCATCGTCGTGGAGAATG Chr14:57253121..57253140 59.65 45
downstream ENSMUSE00000429789 Chr14:57254564..57254659 TTTCTCAACTGCCACAAAGC Chr14:57254659..57254678 59.05 45
downstream ENSMUSE00000429786 Chr14:57256685..57256807 TTCCTGCCAACTCACGTATG Chr14:57256783..57256802 59.72 50
downstream ENSMUSE00000429782 Chr14:57260092..57260154 CCATGGCCATCAGAGAGTTT Chr14:57260147..57260166 60.07 50
downstream ENSMUSE00000429778 Chr14:57266011..57266064 CTTCAGAGGAGACGGAAACG Chr14:57266035..57266054 59.98 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CGGTAGTAATCGCCTTGCAG Chr14:57200613..57200633 60.78 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTTAGGGCTCCTTTTCGTGA Chr14:57200604..57200624 59.45 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000054509