Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI20995
Trapped Gene
Dppa2 (ENSMUSG00000072419)
Vector Insertion
Chr 16: 48314296 - 48315774
Public Clones IST15052F9 (tigm) IST15052G9 (tigm) IST15052G10 (tigm)
Private Clones OST346363 (lexicon) OST67098 (lexicon)
Severity of mutation (?) Insertion after 41% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000699687 (Chr16:48314242..48314295 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000699687 (Chr16:48314242..48314295 +)
Downstram Exon
ENSMUSE00000699686 (Chr16:48315775..48316030 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon GCTGCAAATGTGGACTCCTT Chr16:48315938..48315957 60.26 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000699690 Chr16:48310590..48310652 TCATACTTCGGCCTGGAGAC Chr16:48310623..48310642 60.22 55
upstream ENSMUSE00000629029 Chr16:48311688..48311823 TTTAACGCTGGTCCCCTTTA Chr16:48311726..48311745 59.58 45
upstream ENSMUSE00000699688 Chr16:48313996..48314147 TGCCTCCTATTAGGGACGTG Chr16:48314071..48314090 60.09 55
upstream ENSMUSE00000699687 Chr16:48314242..48314295 No primer for this exon

*** Putative Vector Insertion (Chr 16: 48314296 - 48315774) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000699686 Chr16:48315775..48316030 GCTGCAAATGTGGACTCCTT Chr16:48315938..48315957 60.26 50
downstream ENSMUSE00000699684 Chr16:48317401..48317596 TACAGGCCGGTAACAGGAAG Chr16:48317544..48317563 60.12 55
downstream ENSMUSE00000699682 Chr16:48318746..48319625 GTTAAAATGCAACGGGCTGT Chr16:48319027..48319046 60 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCTCTCCCTGTGGATAATCG Chr16:48314333..48314353 59.65 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTCTCCCTGTGGACGTGACT Chr16:48314334..48314354 60.31 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000072419