Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI20998
Trapped Gene
Dars (ENSMUSG00000026356)
Vector Insertion
Chr 1: 130310330 - 130311930
Public Clones (sanger)
Private Clones OST346303 (lexicon) OST338763 (lexicon) OST332614 (lexicon) OST313559 (lexicon)
OST245906 (lexicon) OST225202 (lexicon) OST218957 (lexicon) OST218130 (lexicon)
OST184839 (lexicon) OST182357 (lexicon) OST168785 (lexicon) OST52087 (lexicon)
Severity of mutation (?) Insertion after 8% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000158352 (Chr1:130311931..130311988 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000158352 (Chr1:130311931..130311988 -)
Downstram Exon
ENSMUSE00000158349 (Chr1:130310237..130310329 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon ACGGACCCAAACAACATCAT Chr1:130310243..130310262 60.1 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000539985 Chr1:130313729..130313902 GGTATCCACTCCCCAAATCC Chr1:130313804..130313823 60.39 55
upstream ENSMUSE00000158352 Chr1:130311931..130311988 No primer for this exon

*** Putative Vector Insertion (Chr 1: 130310330 - 130311930) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000158349 Chr1:130310237..130310329 ACGGACCCAAACAACATCAT Chr1:130310243..130310262 60.1 45
downstream ENSMUSE00000539984 Chr1:130308925..130308971 AAGAACAAACGGTCGGTAGG Chr1:130308922..130308941 59.1 50
downstream ENSMUSE00000158353 Chr1:130301943..130302045 No primer for this exon
downstream ENSMUSE00000158360 Chr1:130287848..130287950 TCAACATCCTGCTGGGTACA Chr1:130287842..130287861 60.11 50
downstream ENSMUSE00000158363 Chr1:130285696..130285776 GTTCAGCCAAGCTGATCACA Chr1:130285730..130285749 59.99 50
downstream ENSMUSE00000158359 Chr1:130283694..130283753 No primer for this exon
downstream ENSMUSE00000158358 Chr1:130275343..130275454 TTCTCGGAAGAGATGGCAGA Chr1:130275373..130275392 61.03 50
downstream ENSMUSE00000158361 Chr1:130272755..130272889 AAACATTGGCTCCTCCTTCA Chr1:130272841..130272860 59.67 45
downstream ENSMUSE00000158348 Chr1:130270514..130270661 TGCACCAAAGTGTCAGCAAT Chr1:130270516..130270535 60.31 45
downstream ENSMUSE00000158362 Chr1:130268717..130268863 CATCGTCCATTTCAACTCCA Chr1:130268708..130268727 59.5 45
downstream ENSMUSE00000158357 Chr1:130266070..130266112 CCAAACGACCCAACAGTTTT Chr1:130266059..130266078 59.87 45
downstream ENSMUSE00000158354 Chr1:130264942..130265022 TGGGTCAGGCATGGTATAGA Chr1:130264929..130264948 58.95 50
downstream ENSMUSE00000158350 Chr1:130263498..130263609 CATGGATTCTTTGTGCTCCA Chr1:130263518..130263537 59.65 45
downstream ENSMUSE00000158356 Chr1:130263275..130263346 CAAAGCGGAAGGAATCAATG Chr1:130263283..130263302 60.58 45
downstream ENSMUSE00000343891 Chr1:130260285..130260902 GTGGCTTTAAGGCGTGAGTC Chr1:130260783..130260802 59.88 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr1:130311859..130311879 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AATAGGCGTGACTGGGAAAAC Chr1:130311864..130311885 60.37 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 AAGTAATCGCCTTGCAGCAC Chr1:130311921..130311941 60.42 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 ACAAGCGTGACTGGGAAAAC Chr1:130311923..130311943 60.16 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000026356