Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI210
Trapped Gene
Mnt (ENSMUSG00000000282)
Vector Insertion
Chr 11: 74644904 - 74649864
Public Clones GC0636 (tigem) (sanger) CSH612 (baygenomics) CSG363 (baygenomics) (ggtc)
Private Clones OST378230 (lexicon) OST367830 (lexicon)
Severity of mutation (?) Insertion after 4% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000336818 (Chr11:74644426..74644903 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000336818 (Chr11:74644426..74644903 +)
Downstram Exon
ENSMUSE00000110573 (Chr11:74649865..74650450 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000336818 Chr11:74644426..74644903 No primer for this exon

*** Putative Vector Insertion (Chr 11: 74644904 - 74649864) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000110573 Chr11:74649865..74650450 No primer for this exon
downstream ENSMUSE00000110570 Chr11:74650933..74650974 No primer for this exon
downstream ENSMUSE00000372733 Chr11:74651114..74651225 No primer for this exon
downstream ENSMUSE00000110571 Chr11:74655663..74655855 No primer for this exon
downstream ENSMUSE00000394187 Chr11:74656053..74659212 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAACAGAGAGCACGTGGTGA Chr11:74644889..74644909 61.09 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAACAGAGAGCACGTGGTGA Chr11:74644889..74644909 61.09 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000000282