Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI2100
Trapped Gene
Ndufaf2 (ENSMUSG00000068184)
Vector Insertion
Chr 13: 108843149 - 108871546
Public Clones AL0243 (sanger) AC0266 (sanger) XN390 (baygenomics) CMHD-GT_249F1-3 (cmhd)
Private Clones OST201841 (lexicon) OST17574 (lexicon)
Severity of mutation (?) Insertion after 52% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000120093 (Chr13:108871547..108871587 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAAGGAAGACTCCACCCACT Chr13:108871553..108871572 59.15 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000120093 (Chr13:108871547..108871587 -)
Downstram Exon
ENSMUSE00000348397 (Chr13:108842897..108843148 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAAGGAAGACTCCACCCACT Chr13:108871553..108871572 59.15 55 AGAGGCGTGCCCTTTAACTT Chr13:108842986..108843005 60.26 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000375362 Chr13:108948637..108948785 ACGTCGCCGAGTACAAGAAC Chr13:108948644..108948663 60.32 55
upstream ENSMUSE00000317502 Chr13:108881728..108881817 AGCAGCGAACAGAAAAGAGG Chr13:108881767..108881786 59.76 50
upstream ENSMUSE00000120093 Chr13:108871547..108871587 CAAGGAAGACTCCACCCACT Chr13:108871553..108871572 59.15 55

*** Putative Vector Insertion (Chr 13: 108843149 - 108871546) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000348397 Chr13:108842897..108843148 AGAGGCGTGCCCTTTAACTT Chr13:108842986..108843005 60.26 50
downstream ENSMUSE00000706094 Chr13:108842785..108842843 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCTCGCATCACTGGATAACA Chr13:108862512..108862532 59.67 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGCAGGAGAGGTAGCAACAA Chr13:108844571..108844591 60.4 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000068184