Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI21005
Trapped Gene
Atp9a (ENSMUSG00000027546)
Vector Insertion
Chr 2: 168512936 - 168514798
Public Clones CMHD-GT_258C06-3 (cmhd) (cmhd) IST13190G2 (tigm) IST13190G4 (tigm)
IST13190G2 (tigm)
Private Clones OST346101 (lexicon)
Severity of mutation (?) Insertion after 16% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000679308 (Chr2:168514799..168514850 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGTCCCTGCTGACATGATCT Chr2:168514823..168514842 60.08 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000679308 (Chr2:168514799..168514850 -)
Downstram Exon
ENSMUSE00000679305 (Chr2:168512841..168512935 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGTCCCTGCTGACATGATCT Chr2:168514823..168514842 60.08 55 CCGAAGCTTCCAGTCTGTCT Chr2:168512858..168512877 59.6 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000679310 Chr2:168567655..168567821 ATTGATGCCACAGGGTGTGT Chr2:168567779..168567798 61.27 50
upstream ENSMUSE00000679327 Chr2:168567588..168567633 GGAGCGAGCAGGAGAGAATG Chr2:168567599..168567618 62.53 60
upstream ENSMUSE00000232466 Chr2:168567182..168567464 AAGAAGCGGGTGGACAGTAG Chr2:168567194..168567213 59.35 55
upstream ENSMUSE00000679269 Chr2:168567182..168567300 AAGAAGCGGGTGGACAGTAG Chr2:168567194..168567213 59.35 55
upstream ENSMUSE00000679313 Chr2:168567182..168567462 AAGAAGCGGGTGGACAGTAG Chr2:168567194..168567213 59.35 55
upstream ENSMUSE00000679312 Chr2:168559521..168559540 No primer for this exon
upstream ENSMUSE00000679274 Chr2:168536576..168536580 No primer for this exon
upstream ENSMUSE00000679311 Chr2:168536530..168536543 No primer for this exon
upstream ENSMUSE00000416040 Chr2:168536332..168536476 CGTACTGTCTGGTTGGGACA Chr2:168536411..168536430 59.59 55
upstream ENSMUSE00000416034 Chr2:168531695..168531808 AGTTCGTCCCAGAGATGAGG Chr2:168531728..168531747 59.25 55
upstream ENSMUSE00000679268 Chr2:168531363..168531365 No primer for this exon
upstream ENSMUSE00000716903 Chr2:168530623..168530731 ATCCGATGTTATGTGCGTGA Chr2:168530667..168530686 59.96 45
upstream ENSMUSE00000718900 Chr2:168530623..168530731 ATCCGATGTTATGTGCGTGA Chr2:168530667..168530686 59.96 45
upstream ENSMUSE00000679272 Chr2:168516466..168516524 CAAACATCCAGGTGGGAGAC Chr2:168516484..168516503 60.36 55
upstream ENSMUSE00000708606 Chr2:168516466..168516524 CAAACATCCAGGTGGGAGAC Chr2:168516484..168516503 60.36 55
upstream ENSMUSE00000710545 Chr2:168516466..168516524 CAAACATCCAGGTGGGAGAC Chr2:168516484..168516503 60.36 55
upstream ENSMUSE00000170425 Chr2:168514799..168514850 GGTCCCTGCTGACATGATCT Chr2:168514823..168514842 60.08 55
upstream ENSMUSE00000679308 Chr2:168514799..168514850 GGTCCCTGCTGACATGATCT Chr2:168514823..168514842 60.08 55

*** Putative Vector Insertion (Chr 2: 168512936 - 168514798) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000170420 Chr2:168512841..168512935 CCGAAGCTTCCAGTCTGTCT Chr2:168512858..168512877 59.6 55
downstream ENSMUSE00000679305 Chr2:168512841..168512935 CCGAAGCTTCCAGTCTGTCT Chr2:168512858..168512877 59.6 55
downstream ENSMUSE00000170433 Chr2:168509213..168509293 GAATGTCGATGTTGGGCTCT Chr2:168509217..168509236 60.08 50
downstream ENSMUSE00000679300 Chr2:168509213..168509293 GAATGTCGATGTTGGGCTCT Chr2:168509217..168509236 60.08 50
downstream ENSMUSE00000170424 Chr2:168507476..168507551 ACTGATCGGAGGGTCACTGT Chr2:168507506..168507525 59.56 55
downstream ENSMUSE00000679298 Chr2:168507476..168507551 ACTGATCGGAGGGTCACTGT Chr2:168507506..168507525 59.56 55
downstream ENSMUSE00000170422 Chr2:168501642..168501718 TGACACTCCGCAGTTCTCTG Chr2:168501646..168501665 60.18 55
downstream ENSMUSE00000679297 Chr2:168501642..168501718 TGACACTCCGCAGTTCTCTG Chr2:168501646..168501665 60.18 55
downstream ENSMUSE00000170421 Chr2:168500701..168500861 GGATCTTGGTGAGGCAGTTC Chr2:168500797..168500816 59.66 55
downstream ENSMUSE00000679296 Chr2:168500701..168500861 GGATCTTGGTGAGGCAGTTC Chr2:168500797..168500816 59.66 55
downstream ENSMUSE00000232408 Chr2:168500292..168500434 GGAATTGTGCTGGAACGAAC Chr2:168500314..168500333 60.5 50
downstream ENSMUSE00000679295 Chr2:168500292..168500434 GGAATTGTGCTGGAACGAAC Chr2:168500314..168500333 60.5 50
downstream ENSMUSE00000170440 Chr2:168498977..168499089 CCATCTCATTCTGGGTCAGG Chr2:168499044..168499063 60.47 55
downstream ENSMUSE00000679294 Chr2:168498977..168499089 CCATCTCATTCTGGGTCAGG Chr2:168499044..168499063 60.47 55
downstream ENSMUSE00000170430 Chr2:168493506..168493718 GTGTCACGTTGTGGCAGAGT Chr2:168493579..168493598 59.79 55
downstream ENSMUSE00000679293 Chr2:168493506..168493718 GTGTCACGTTGTGGCAGAGT Chr2:168493579..168493598 59.79 55
downstream ENSMUSE00000170436 Chr2:168487429..168487590 TAGGTGAACGGGAAGACCTG Chr2:168487438..168487457 60.1 55
downstream ENSMUSE00000679291 Chr2:168487429..168487590 TAGGTGAACGGGAAGACCTG Chr2:168487438..168487457 60.1 55
downstream ENSMUSE00000170432 Chr2:168479676..168479768 TCCAGCCAGTCGTTGTACTG Chr2:168479661..168479680 59.9 55
downstream ENSMUSE00000679290 Chr2:168479676..168479768 TCCAGCCAGTCGTTGTACTG Chr2:168479661..168479680 59.9 55
downstream ENSMUSE00000170423 Chr2:168478994..168479077 GGACTTCTTGGCTACCACCA Chr2:168479002..168479021 60.11 55
downstream ENSMUSE00000679289 Chr2:168478994..168479077 GGACTTCTTGGCTACCACCA Chr2:168479002..168479021 60.11 55
downstream ENSMUSE00000415943 Chr2:168478068..168478238 CAGCTTAGCCTGGACGTAGC Chr2:168478193..168478212 60.18 60
downstream ENSMUSE00000679288 Chr2:168478068..168478238 CAGCTTAGCCTGGACGTAGC Chr2:168478193..168478212 60.18 60
downstream ENSMUSE00000170439 Chr2:168475029..168475127 GCTTGTCCCCTGTTAGCATC Chr2:168475081..168475100 59.7 55
downstream ENSMUSE00000679287 Chr2:168475029..168475127 GCTTGTCCCCTGTTAGCATC Chr2:168475081..168475100 59.7 55
downstream ENSMUSE00000170438 Chr2:168474291..168474380 CTACGGAAGGCATTCAGCTC Chr2:168474312..168474331 59.98 55
downstream ENSMUSE00000679286 Chr2:168474291..168474380 CTACGGAAGGCATTCAGCTC Chr2:168474312..168474331 59.98 55
downstream ENSMUSE00000170427 Chr2:168474055..168474199 TACTGCACAGGTGAGCTTCC Chr2:168474034..168474053 59.04 55
downstream ENSMUSE00000679285 Chr2:168474055..168474199 TACTGCACAGGTGAGCTTCC Chr2:168474034..168474053 59.04 55
downstream ENSMUSE00000170431 Chr2:168473185..168473249 CAGTCGGATTCCTGGATCAT Chr2:168473185..168473204 59.89 50
downstream ENSMUSE00000679284 Chr2:168473185..168473249 CAGTCGGATTCCTGGATCAT Chr2:168473185..168473204 59.89 50
downstream ENSMUSE00000232333 Chr2:168469362..168469517 No primer for this exon
downstream ENSMUSE00000679283 Chr2:168469362..168469517 No primer for this exon
downstream ENSMUSE00000232326 Chr2:168466131..168466195 TGGTAGAGAGGAACGGATGC Chr2:168466127..168466146 60.22 55
downstream ENSMUSE00000679282 Chr2:168466131..168466195 TGGTAGAGAGGAACGGATGC Chr2:168466127..168466146 60.22 55
downstream ENSMUSE00000232318 Chr2:168465382..168465490 GAGAACACGGGAAACATCGT Chr2:168465433..168465452 59.97 50
downstream ENSMUSE00000679281 Chr2:168465382..168465490 GAGAACACGGGAAACATCGT Chr2:168465433..168465452 59.97 50
downstream ENSMUSE00000170442 Chr2:168464570..168464627 AAGAACGTCTTGTAGGACAGTGG Chr2:168464577..168464599 59.73 47.83
downstream ENSMUSE00000679279 Chr2:168464570..168464627 AAGAACGTCTTGTAGGACAGTGG Chr2:168464577..168464599 59.73 47.83
downstream ENSMUSE00000170444 Chr2:168463001..168463204 GAAGGAGATTGCCACGATGT Chr2:168463112..168463131 60.08 50
downstream ENSMUSE00000679277 Chr2:168463001..168463204 GAAGGAGATTGCCACGATGT Chr2:168463112..168463131 60.08 50
downstream ENSMUSE00000679270 Chr2:168460261..168460408 AGGTGATGACGGACACCTTC Chr2:168460333..168460352 59.97 55
downstream ENSMUSE00000416049 Chr2:168459963..168460408 AGGTGATGACGGACACCTTC Chr2:168460333..168460352 59.97 55
downstream ENSMUSE00000679275 Chr2:168459963..168460408 AGGTGATGACGGACACCTTC Chr2:168460333..168460352 59.97 55
downstream ENSMUSE00000679315 Chr2:168459938..168460408 AGGTGATGACGGACACCTTC Chr2:168460333..168460352 59.97 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000027546