Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI21015
Trapped Gene
Ccnl2 (ENSMUSG00000029068)
Vector Insertion
Chr 4: 155187352 - 155187567
Public Clones not available
Private Clones OST345839 (lexicon) OST105120 (lexicon)
Severity of mutation (?) Insertion after 23% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000185195 (Chr4:155187277..155187351 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTACAGGGCAGGTGCTGTTC Chr4:155187287..155187306 60.85 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000185195 (Chr4:155187277..155187351 +)
Downstram Exon
ENSMUSE00000185200 (Chr4:155187568..155187677 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTACAGGGCAGGTGCTGTTC Chr4:155187287..155187306 60.85 60 TCGTCTCGGAGCCTCTTCTA Chr4:155187627..155187646 60.23 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000523689 Chr4:155186621..155186918 CTCATCACCTTGGAAAACTGC Chr4:155186766..155186786 59.73 47.62
upstream ENSMUSE00000185195 Chr4:155187277..155187351 CTACAGGGCAGGTGCTGTTC Chr4:155187287..155187306 60.85 60

*** Putative Vector Insertion (Chr 4: 155187352 - 155187567) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000185200 Chr4:155187568..155187677 TCGTCTCGGAGCCTCTTCTA Chr4:155187627..155187646 60.23 55
downstream ENSMUSE00000185199 Chr4:155189352..155189472 TTGAGAACCCGTCTCTCTGC Chr4:155189435..155189454 60.53 55
downstream ENSMUSE00000185197 Chr4:155192032..155192096 CCAGGTGTTGATTACGCTCA Chr4:155192086..155192105 59.72 50
downstream ENSMUSE00000185203 Chr4:155192032..155192067 No primer for this exon
downstream ENSMUSE00000705418 Chr4:155192648..155192669 No primer for this exon
downstream ENSMUSE00000185194 Chr4:155194438..155194537 ATCTGTGCGAAGGCTGTCAT Chr4:155194471..155194490 60.83 50
downstream ENSMUSE00000523690 Chr4:155194893..155194997 TGTGGACGATTGGGTAAAGG Chr4:155194918..155194937 60.74 50
downstream ENSMUSE00000185201 Chr4:155195082..155195223 CTCCAGATGCGTCAAATCAA Chr4:155195105..155195124 59.8 45
downstream ENSMUSE00000185193 Chr4:155195921..155196029 GGAAGGCTTGCCTCCTTTAC Chr4:155195958..155195977 60.21 55
downstream ENSMUSE00000185192 Chr4:155196114..155196206 CTGCTCACGACTCCTGCTTT Chr4:155196165..155196184 60.73 55
downstream ENSMUSE00000228484 Chr4:155197452..155198460 AGCCACCAGGGATCCTATCT Chr4:155197828..155197847 59.92 55
downstream ENSMUSE00000414644 Chr4:155197669..155197806 AGCGCTCACGTCTTTGATCT Chr4:155197738..155197757 60.16 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGATGAAACCTGGCTAATCG Chr4:155187389..155187409 59.53 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCCATGGAGGTAGGCTTCTTT Chr4:155187344..155187365 60.08 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029068