Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI21022
Trapped Gene
Cldn13 (ENSMUSG00000008843)
Vector Insertion
Chr 5: 135390361 - 135390571
Public Clones CMHD-GT_447F1-3 (cmhd) CMHD-GT_514F11-3 (cmhd)
Private Clones OST345721 (lexicon) OST330818 (lexicon) OST325699 (lexicon) OST169865 (lexicon)
OST130947 (lexicon)
Severity of mutation (?) Insertion after 99% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000191407 (Chr5:135390572..135391396 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000191407 (Chr5:135390572..135391396 -)
Downstram Exon
ENSMUSE00000687106 (Chr5:135390120..135390360 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000191407 Chr5:135390572..135391396 No primer for this exon

*** Putative Vector Insertion (Chr 5: 135390361 - 135390571) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000687106 Chr5:135390120..135390360 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GACCTTCAGGAGCCAACAAC Chr5:135390580..135390600 59.7 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GACCTTCAGGAGCCAACAAC Chr5:135390580..135390600 59.7 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000008843