Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI21026
Trapped Gene
Kif1a (ENSMUSG00000014602)
Vector Insertion
Chr 1: 94979058 - 94998339
Public Clones not available
Private Clones OST345547 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000541517 (Chr1:94998340..94998430 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000541517 (Chr1:94998340..94998430 -)
Downstram Exon
ENSMUSE00000713157 (Chr1:94978893..94979057 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000541517 Chr1:94998340..94998430 No primer for this exon

*** Putative Vector Insertion (Chr 1: 94979058 - 94998339) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000711516 Chr1:94978893..94979057 No primer for this exon
downstream ENSMUSE00000713157 Chr1:94978893..94979057 No primer for this exon
downstream ENSMUSE00000157439 Chr1:94975338..94975414 No primer for this exon
downstream ENSMUSE00000693774 Chr1:94975338..94975414 No primer for this exon
downstream ENSMUSE00000157424 Chr1:94974265..94974444 No primer for this exon
downstream ENSMUSE00000693772 Chr1:94974265..94974444 No primer for this exon
downstream ENSMUSE00000157422 Chr1:94973619..94973684 No primer for this exon
downstream ENSMUSE00000693771 Chr1:94973619..94973684 No primer for this exon
downstream ENSMUSE00000541579 Chr1:94972728..94972906 No primer for this exon
downstream ENSMUSE00000693769 Chr1:94972728..94972906 No primer for this exon
downstream ENSMUSE00000285404 Chr1:94971533..94971644 No primer for this exon
downstream ENSMUSE00000693768 Chr1:94971533..94971644 No primer for this exon
downstream ENSMUSE00000157432 Chr1:94970385..94970462 No primer for this exon
downstream ENSMUSE00000693766 Chr1:94970385..94970462 No primer for this exon
downstream ENSMUSE00000402857 Chr1:94969616..94969681 No primer for this exon
downstream ENSMUSE00000693764 Chr1:94969616..94969681 No primer for this exon
downstream ENSMUSE00000693824 Chr1:94968885..94968902 No primer for this exon
downstream ENSMUSE00000541572 Chr1:94965062..94965137 No primer for this exon
downstream ENSMUSE00000370345 Chr1:94963633..94963711 No primer for this exon
downstream ENSMUSE00000157440 Chr1:94962624..94962766 No primer for this exon
downstream ENSMUSE00000693763 Chr1:94962129..94962155 No primer for this exon
downstream ENSMUSE00000285366 Chr1:94960726..94960859 No primer for this exon
downstream ENSMUSE00000541564 Chr1:94959444..94959523 No primer for this exon
downstream ENSMUSE00000157435 Chr1:94959077..94959152 No primer for this exon
downstream ENSMUSE00000466526 Chr1:94957315..94957394 No primer for this exon
downstream ENSMUSE00000157434 Chr1:94956774..94956880 No primer for this exon
downstream ENSMUSE00000157431 Chr1:94955391..94955474 No primer for this exon
downstream ENSMUSE00000693762 Chr1:94952691..94952857 No primer for this exon
downstream ENSMUSE00000541556 Chr1:94952677..94952857 No primer for this exon
downstream ENSMUSE00000157429 Chr1:94952534..94952606 No primer for this exon
downstream ENSMUSE00000285319 Chr1:94952262..94952355 No primer for this exon
downstream ENSMUSE00000285311 Chr1:94951393..94951541 No primer for this exon
downstream ENSMUSE00000285305 Chr1:94950837..94951015 No primer for this exon
downstream ENSMUSE00000285298 Chr1:94949001..94949138 No primer for this exon
downstream ENSMUSE00000541545 Chr1:94943229..94943347 No primer for this exon
downstream ENSMUSE00000693761 Chr1:94943229..94943238 No primer for this exon
downstream ENSMUSE00000285281 Chr1:94940166..94940251 No primer for this exon
downstream ENSMUSE00000285271 Chr1:94939193..94939331 No primer for this exon
downstream ENSMUSE00000285261 Chr1:94938920..94939088 No primer for this exon
downstream ENSMUSE00000285253 Chr1:94938662..94938752 No primer for this exon
downstream ENSMUSE00000285242 Chr1:94938151..94938269 No primer for this exon
downstream ENSMUSE00000285231 Chr1:94937196..94937251 No primer for this exon
downstream ENSMUSE00000285224 Chr1:94936322..94936430 No primer for this exon
downstream ENSMUSE00000285215 Chr1:94935794..94935860 No primer for this exon
downstream ENSMUSE00000285205 Chr1:94935612..94935696 No primer for this exon
downstream ENSMUSE00000285196 Chr1:94933423..94933528 No primer for this exon
downstream ENSMUSE00000693786 Chr1:94923409..94923432 No primer for this exon
downstream ENSMUSE00000285189 Chr1:94922198..94922312 No primer for this exon
downstream ENSMUSE00000285182 Chr1:94921156..94921289 No primer for this exon
downstream ENSMUSE00000285177 Chr1:94920036..94920097 No primer for this exon
downstream ENSMUSE00000285170 Chr1:94919503..94919648 No primer for this exon
downstream ENSMUSE00000285164 Chr1:94918898..94919098 No primer for this exon
downstream ENSMUSE00000285156 Chr1:94918303..94918380 No primer for this exon
downstream ENSMUSE00000285149 Chr1:94917790..94917914 No primer for this exon
downstream ENSMUSE00000285143 Chr1:94917035..94917187 No primer for this exon
downstream ENSMUSE00000285135 Chr1:94916384..94916576 No primer for this exon
downstream ENSMUSE00000285127 Chr1:94915529..94915647 No primer for this exon
downstream ENSMUSE00000659806 Chr1:94914858..94915076 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATACCACCTTGAAGGGCACA Chr1:94992344..94992364 60.38 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATACCACCTTGAAGGGCACA Chr1:94992344..94992364 60.38 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000014602