Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI21030
Trapped Gene
Centa2 (ENSMUSG00000020709)
Vector Insertion
Chr 11: 79989636 - 79990547
Public Clones IST11811B2 (tigm) IST14577D2 (tigm) IST14182H9 (tigm) IST12077C1 (tigm)
IST11812B1 (tigm) IST14886A1 (tigm) IST14182H9 (tigm) IST13723E10 (tigm)
IST12077B2 (tigm)
Private Clones OST345519 (lexicon)
Severity of mutation (?) Insertion after 77% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000108353 (Chr11:79989558..79989635 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000108353 (Chr11:79989558..79989635 +)
Downstram Exon
ENSMUSE00000373060 (Chr11:79990548..79990776 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000349664 Chr11:79967613..79967811 No primer for this exon
upstream ENSMUSE00000283569 Chr11:79968492..79968622 No primer for this exon
upstream ENSMUSE00000108355 Chr11:79970447..79970538 No primer for this exon
upstream ENSMUSE00000108361 Chr11:79973665..79973744 No primer for this exon
upstream ENSMUSE00000108363 Chr11:79975650..79975762 No primer for this exon
upstream ENSMUSE00000108358 Chr11:79979175..79979321 No primer for this exon
upstream ENSMUSE00000108360 Chr11:79984180..79984263 No primer for this exon
upstream ENSMUSE00000108356 Chr11:79987590..79987652 No primer for this exon
upstream ENSMUSE00000108353 Chr11:79989558..79989635 No primer for this exon

*** Putative Vector Insertion (Chr 11: 79989636 - 79990547) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000373060 Chr11:79990548..79990776 No primer for this exon
downstream ENSMUSE00000332693 Chr11:79991898..79992417 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGAACGGAGGCTGCTCTATT Chr11:79989603..79989623 60.73 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGAACGGAGGCTGCTCTATT Chr11:79989603..79989623 60.73 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000020709