Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI21032
Trapped Gene
Ccdc58 (ENSMUSG00000075229)
Vector Insertion
Chr 16: 36082903 - 36085102
Public Clones not available
Private Clones OST345322 (lexicon)
Severity of mutation (?) Insertion after 41% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000644039 (Chr16:36082777..36082902 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TACGGTTCCAACAGCTTCCT Chr16:36082833..36082852 59.73 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000644039 (Chr16:36082777..36082902 +)
Downstram Exon
ENSMUSE00000644038 (Chr16:36085103..36085249 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TACGGTTCCAACAGCTTCCT Chr16:36082833..36082852 59.73 50 CTGACATGAGCTGCCATCAA Chr16:36085125..36085144 60.99 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000644041 Chr16:36072173..36072223 CTGTGAAGAGTTCGCCGAGT Chr16:36072199..36072218 60.59 55
upstream ENSMUSE00000644039 Chr16:36082777..36082902 TACGGTTCCAACAGCTTCCT Chr16:36082833..36082852 59.73 50

*** Putative Vector Insertion (Chr 16: 36082903 - 36085102) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000644038 Chr16:36085103..36085249 CTGACATGAGCTGCCATCAA Chr16:36085125..36085144 60.99 50
downstream ENSMUSE00000644037 Chr16:36089987..36090046 No primer for this exon
downstream ENSMUSE00000644036 Chr16:36091920..36092204 GCGATGAGATGACCGAGTCT Chr16:36092009..36092028 60.38 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATGCCAGCCAAACCTGTAAA Chr16:36082869..36082889 60.5 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTTCTTTCGTGACTGGGAAAA Chr16:36082947..36082968 59.71 38.1 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000075229