Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI21033
Trapped Gene
Tnip2 (ENSMUSG00000059866)
Vector Insertion
Chr 5: 34856267 - 34856588
Public Clones not available
Private Clones OST345252 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000469962 (Chr5:34856268..34856628 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GACGCACTTCTGGATCAGGT Chr5:34856332..34856351 60.27 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000469962 (Chr5:34856268..34856628 -)
Downstram Exon
ENSMUSE00000367490 (Chr5:34856268..34856587 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GACGCACTTCTGGATCAGGT Chr5:34856332..34856351 60.27 55 CTTCAGGCGCTGTAGTTGCT Chr5:34856417..34856436 60.73 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000367490 Chr5:34856268..34856587 GACGCACTTCTGGATCAGGT Chr5:34856332..34856351 60.27 55
upstream ENSMUSE00000469962 Chr5:34856268..34856628 GACGCACTTCTGGATCAGGT Chr5:34856332..34856351 60.27 55

*** Putative Vector Insertion (Chr 5: 34856267 - 34856588) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000478031 Chr5:34846186..34846476 GTGCACACTGTCGTTCATCC Chr5:34846196..34846215 60.17 55
downstream ENSMUSE00000476528 Chr5:34844107..34844169 TTCAGGTCCTTGGTGTAGGC Chr5:34844104..34844123 60.11 55
downstream ENSMUSE00000482084 Chr5:34843557..34843646 ATCGCTGCTTGTTTGCTCTA Chr5:34843604..34843623 58.82 45
downstream ENSMUSE00000479628 Chr5:34842137..34842385 TGCTTCCGCACAGTCACTTA Chr5:34842187..34842206 60.6 50
downstream ENSMUSE00000511157 Chr5:34841829..34841948 AATCCTACTGTGCGCTCGTT Chr5:34841861..34841880 59.9 50
downstream ENSMUSE00000547751 Chr5:34838779..34839599 ATCCCAGGAGAATGCAACAC Chr5:34839209..34839228 59.93 50
downstream ENSMUSE00000467889 Chr5:34838745..34839599 ATCCCAGGAGAATGCAACAC Chr5:34839209..34839228 59.93 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTCGTCTAATCGCCTTGCAG Chr5:34856523..34856543 60.93 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCTGTGTGGAGAAGTTGGAGA Chr5:34856575..34856596 60.28 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000059866