Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI21043
Trapped Gene
Wfdc3 (ENSMUSG00000076434)
Vector Insertion
Chr 2: 164559812 - 164568528
Public Clones not available
Private Clones OST344976 (lexicon)
Severity of mutation (?) Insertion after 15% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000661255 (Chr2:164568529..164568767 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCCTGAACTGAGCTCCTGAC Chr2:164568624..164568643 59.99 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000661255 (Chr2:164568529..164568767 -)
Downstram Exon
ENSMUSE00000679925 (Chr2:164559680..164559811 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCCTGAACTGAGCTCCTGAC Chr2:164568624..164568643 59.99 60 ATTCGTCTCCGGTACACAGC Chr2:164559727..164559746 60.14 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000720304 Chr2:164571333..164571431 TAGGAGCCACCTCGTCTTTG Chr2:164571392..164571411 60.39 55
upstream ENSMUSE00000661255 Chr2:164568529..164568767 CCCTGAACTGAGCTCCTGAC Chr2:164568624..164568643 59.99 60

*** Putative Vector Insertion (Chr 2: 164559812 - 164568528) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000661254 Chr2:164559680..164559811 ATTCGTCTCCGGTACACAGC Chr2:164559727..164559746 60.14 55
downstream ENSMUSE00000679925 Chr2:164559680..164559811 ATTCGTCTCCGGTACACAGC Chr2:164559727..164559746 60.14 55
downstream ENSMUSE00000661253 Chr2:164557508..164557693 CCCGGATTGACAGTTCTCAT Chr2:164557592..164557611 59.93 50
downstream ENSMUSE00000679924 Chr2:164557508..164557693 CCCGGATTGACAGTTCTCAT Chr2:164557592..164557611 59.93 50
downstream ENSMUSE00000679929 Chr2:164556726..164556988 CTGCCTCAGTGATGCCTACA Chr2:164556743..164556762 60.01 55
downstream ENSMUSE00000661252 Chr2:164556680..164556988 CTGCCTCAGTGATGCCTACA Chr2:164556743..164556762 60.01 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGTCACAAGCACTCGTTGGA Chr2:164565556..164565576 59.47 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGTCACAAGCACTCGTTGGA Chr2:164565556..164565576 59.47 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000076434