Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI21046
Trapped Gene
Smyd2 (ENSMUSG00000026603)
Vector Insertion
Chr 1: 191721363 - 191723696
Public Clones not available
Private Clones OST344928 (lexicon) OST121461 (lexicon)
Severity of mutation (?) Insertion after 27% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000289233 (Chr1:191723697..191723807 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAATCCTTCGGAGACTGTGC Chr1:191723726..191723745 59.81 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000289233 (Chr1:191723697..191723807 -)
Downstram Exon
ENSMUSE00000289226 (Chr1:191721302..191721362 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAATCCTTCGGAGACTGTGC Chr1:191723726..191723745 59.81 55 TGTCCTCTCTGGGTGGATTT Chr1:191721320..191721339 59.51 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000289243 Chr1:191745986..191746170 No primer for this exon
upstream ENSMUSE00000289238 Chr1:191733730..191733793 TTCTACTGCGACGTGGAATG Chr1:191733734..191733753 59.86 50
upstream ENSMUSE00000289233 Chr1:191723697..191723807 GAATCCTTCGGAGACTGTGC Chr1:191723726..191723745 59.81 55

*** Putative Vector Insertion (Chr 1: 191721363 - 191723696) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000289226 Chr1:191721302..191721362 TGTCCTCTCTGGGTGGATTT Chr1:191721320..191721339 59.51 50
downstream ENSMUSE00000289221 Chr1:191720450..191720574 GCGATGTCACTCTGGATGAG Chr1:191720501..191720520 59.37 55
downstream ENSMUSE00000289217 Chr1:191715279..191715346 GAATATCGCCGATCCCAAAT Chr1:191715262..191715281 60.99 45
downstream ENSMUSE00000289209 Chr1:191712694..191712796 CAGGGTCCCTTTGTAGGTCA Chr1:191712714..191712733 59.96 55
downstream ENSMUSE00000160915 Chr1:191710400..191710510 CAGGTCGATGTAGCTGGTGA Chr1:191710465..191710484 59.85 55
downstream ENSMUSE00000160912 Chr1:191709178..191709298 CTGAGCTTTCGGACTTCCAC Chr1:191709245..191709264 59.99 55
downstream ENSMUSE00000160911 Chr1:191707703..191707877 TCTTCTGCCCGTATTTCAGG Chr1:191707697..191707716 60.21 50
downstream ENSMUSE00000160914 Chr1:191705988..191706096 TGAGGGAGTACACGGGGTAG Chr1:191706049..191706068 59.98 60
downstream ENSMUSE00000333082 Chr1:191704373..191704745 AAAGCTCAATCTGCCGAAAA Chr1:191704435..191704454 59.96 40

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTGAGGGAATGGGAGAAGGT Chr1:191723675..191723695 60.31 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTGAGGGAATGGGAGAAGGT Chr1:191723675..191723695 60.31 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000026603