Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI21051
Trapped Gene
Exoc3 (ENSMUSG00000034152)
Vector Insertion
Chr 13: 74311597 - 74317882
Public Clones not available
Private Clones OST344586 (lexicon)
Severity of mutation (?) Insertion after 80% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000384118 (Chr13:74317883..74318005 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAAACGCTGTGGACATCATC Chr13:74317943..74317962 60.12 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000384118 (Chr13:74317883..74318005 -)
Downstram Exon
ENSMUSE00000391436 (Chr13:74311435..74311596 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAAACGCTGTGGACATCATC Chr13:74317943..74317962 60.12 50 CTCTTCAGCACTCCGAAAGG Chr13:74311485..74311504 60.13 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000340462 Chr13:74346106..74346139 No primer for this exon
upstream ENSMUSE00000338780 Chr13:74344355..74344545 GCAGTATCGCAGAAGGGAAG Chr13:74344390..74344409 59.98 55
upstream ENSMUSE00000222968 Chr13:74336904..74337123 TTAAGCCAACTGCACAATGC Chr13:74337065..74337084 59.88 45
upstream ENSMUSE00000222962 Chr13:74330056..74330737 GCTGCAAAGATCACTGGTCA Chr13:74330501..74330520 59.99 50
upstream ENSMUSE00000222957 Chr13:74327518..74327635 GCAGAGATGATGGGGAATGT Chr13:74327615..74327634 59.89 50
upstream ENSMUSE00000222951 Chr13:74326609..74326734 CTTCGGAAAGCACTGGAAAC Chr13:74326697..74326716 59.85 50
upstream ENSMUSE00000222946 Chr13:74322121..74322221 GAATCTTCAAGTTGCTGCTCAA Chr13:74322189..74322210 59.64 40.91
upstream ENSMUSE00000381900 Chr13:74319725..74319835 No primer for this exon
upstream ENSMUSE00000346608 Chr13:74319492..74319642 AGACGCCATTGCTAAGGAAG Chr13:74319533..74319552 59.48 50
upstream ENSMUSE00000384118 Chr13:74317883..74318005 CAAACGCTGTGGACATCATC Chr13:74317943..74317962 60.12 50

*** Putative Vector Insertion (Chr 13: 74311597 - 74317882) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000391436 Chr13:74311435..74311596 CTCTTCAGCACTCCGAAAGG Chr13:74311485..74311504 60.13 55
downstream ENSMUSE00000222924 Chr13:74310744..74310871 CACAGTGTCCATCTGCATCC Chr13:74310819..74310838 60.12 55
downstream ENSMUSE00000379311 Chr13:74309441..74309692 AGCTTTGCCACGTTCAGACT Chr13:74309509..74309528 60.06 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TATTAATCGCCTTGCAGCAC Chr13:74317814..74317834 58.94 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACTGGAGCCTACCTCCCATC Chr13:74317839..74317859 60.48 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000034152