Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI21067
Trapped Gene
Csad (ENSMUSG00000023044)
Vector Insertion
Chr 15: 102010034 - 102010259
Public Clones CMHD-GT_465C10-3 (cmhd)
Private Clones OST342615 (lexicon)
Severity of mutation (?) Insertion after 60% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000133125 (Chr15:102010260..102010324 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000133125 (Chr15:102010260..102010324 -)
Downstram Exon
ENSMUSE00000133113 (Chr15:102009952..102010033 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon AGAAGAAGAGCGGAGCACTG Chr15:102009943..102009962 59.89 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000133120 Chr15:102019318..102019474 CTTGTCACCAGCTCGTCTGA Chr15:102019347..102019366 60.18 55
upstream ENSMUSE00000133119 Chr15:102018974..102019110 CATCCTGATGGCTGACTCAA Chr15:102019087..102019106 59.79 50
upstream ENSMUSE00000285174 Chr15:102018613..102018739 GAATGGAAGGAGCCTGAAGA Chr15:102018714..102018733 59.36 50
upstream ENSMUSE00000133114 Chr15:102018438..102018528 ATCACGGAGAGCCTCAACAC Chr15:102018444..102018463 60.27 55
upstream ENSMUSE00000133123 Chr15:102017997..102018103 CGTGTTTGTGCTCATGGAAG Chr15:102018063..102018082 60.3 50
upstream ENSMUSE00000133117 Chr15:102017485..102017600 CAACATGTACGCCATGAACC Chr15:102017568..102017587 59.85 50
upstream ENSMUSE00000133118 Chr15:102016825..102016904 GACAGTGTCCGAGTGGTCAA Chr15:102016837..102016856 59.71 55
upstream ENSMUSE00000133126 Chr15:102016429..102016483 GGAGAGGCAGATCATTCTGG Chr15:102016440..102016459 59.76 55
upstream ENSMUSE00000549222 Chr15:102010402..102010518 ATTTCTGGTCAGTGCCACCT Chr15:102010488..102010507 59.58 50
upstream ENSMUSE00000133125 Chr15:102010260..102010324 No primer for this exon

*** Putative Vector Insertion (Chr 15: 102010034 - 102010259) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000133113 Chr15:102009952..102010033 AGAAGAAGAGCGGAGCACTG Chr15:102009943..102009962 59.89 55
downstream ENSMUSE00000133112 Chr15:102009392..102009591 TGTCCAGAGCCACATCGTAG Chr15:102009491..102009510 59.85 55
downstream ENSMUSE00000133122 Chr15:102009212..102009263 ACTCAAATCCTTCCCGCTTT Chr15:102009201..102009220 60.07 45
downstream ENSMUSE00000133121 Chr15:102008958..102009047 AGAAGCACACGTTGACGAACT Chr15:102009001..102009021 59.97 47.62
downstream ENSMUSE00000133124 Chr15:102007429..102008217 CACCACCATTCGGAAGAAGT Chr15:102008097..102008116 59.97 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr15:102010189..102010209 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTCCAACCCTTGGTTCTCAC Chr15:102010207..102010227 59.94 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000023044