Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI21104
Trapped Gene
AC158617.9 (ENSMUSG00000019767)
Vector Insertion
Chr 10: 5825787 - 5827490
Public Clones not available
Private Clones OST341225 (lexicon)
Severity of mutation (?) Insertion after 28% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000318484 (Chr10:5827491..5827635 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000318484 (Chr10:5827491..5827635 -)
Downstram Exon
ENSMUSE00000318476 (Chr10:5825601..5825786 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000318508 Chr10:5833661..5833846 No primer for this exon
upstream ENSMUSE00000318492 Chr10:5832229..5832485 No primer for this exon
upstream ENSMUSE00000318484 Chr10:5827491..5827635 No primer for this exon

*** Putative Vector Insertion (Chr 10: 5825787 - 5827490) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000318476 Chr10:5825601..5825786 No primer for this exon
downstream ENSMUSE00000318468 Chr10:5812265..5812582 No primer for this exon
downstream ENSMUSE00000318459 Chr10:5804659..5804859 No primer for this exon
downstream ENSMUSE00000318445 Chr10:5799602..5799775 No primer for this exon
downstream ENSMUSE00000306663 Chr10:5796742..5796984 No primer for this exon
downstream ENSMUSE00000306622 Chr10:5787808..5788044 No primer for this exon
downstream ENSMUSE00000341294 Chr10:5785538..5785642 No primer for this exon
downstream ENSMUSE00000577430 Chr10:5785430..5785510 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCATGCAGGTTAAAGGCACT Chr10:5827463..5827483 60.28 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCATGCAGGTTAAAGGCACT Chr10:5827463..5827483 60.28 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000019767