Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI21111
Trapped Gene
Napepld (ENSMUSG00000044968)
Vector Insertion
Chr 5: 21189284 - 21207022
Public Clones D161C09 (ggtc)
Private Clones OST340908 (lexicon) OST176304 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000458392 (Chr5:21207023..21207185 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTCGATATCTGCGTGGAACA Chr5:21207072..21207091 59.82 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000458392 (Chr5:21207023..21207185 -)
Downstram Exon
ENSMUSE00000359041 (Chr5:21188974..21189283 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTCGATATCTGCGTGGAACA Chr5:21207072..21207091 59.82 50 CTGAATTCTGGCGCTTTCTC Chr5:21189164..21189183 60.1 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000458392 Chr5:21207023..21207185 CTCGATATCTGCGTGGAACA Chr5:21207072..21207091 59.82 50
upstream ENSMUSE00000655629 Chr5:21206793..21207212 GCTGTTAGCCTGGATCTTCG Chr5:21207143..21207162 59.98 55

*** Putative Vector Insertion (Chr 5: 21189284 - 21207022) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000386128 Chr5:21189231..21189263 TGGAGACTGGCTGTCCTCAT Chr5:21189216..21189235 60.83 55
downstream ENSMUSE00000336105 Chr5:21188974..21189228 CTGAATTCTGGCGCTTTCTC Chr5:21189164..21189183 60.1 50
downstream ENSMUSE00000359041 Chr5:21188974..21189283 CTGAATTCTGGCGCTTTCTC Chr5:21189164..21189183 60.1 50
downstream ENSMUSE00000715725 Chr5:21188974..21189283 CTGAATTCTGGCGCTTTCTC Chr5:21189164..21189183 60.1 50
downstream ENSMUSE00000401164 Chr5:21181273..21181919 ATGAGCTCGTCCATTTCCAC Chr5:21181764..21181783 60.08 50
downstream ENSMUSE00000383623 Chr5:21176307..21176421 GGGTCTGCATGCTGGTATTT Chr5:21176370..21176389 59.96 50
downstream ENSMUSE00000552507 Chr5:21168798..21171180 CCATCCCTAGACTCCCACAA Chr5:21170866..21170885 59.92 55
downstream ENSMUSE00000702080 Chr5:21168719..21171180 CCATCCCTAGACTCCCACAA Chr5:21170866..21170885 59.92 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTGTGTAGCAGGTGCTTTGC Chr5:21204010..21204030 59.66 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTGTGTAGCAGGTGCTTTGC Chr5:21204010..21204030 59.66 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TTCTAATCGCCTTGCAGCAC Chr5:21204118..21204138 61.44 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CAGGACGTGACTGGGAAAAC Chr5:21204120..21204140 60.54 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000044968