Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI21116
Trapped Gene
Etl4 (ENSMUSG00000036617)
Vector Insertion
Chr 2: 20665085 - 20665919
Public Clones not available
Private Clones OST340718 (lexicon) OST207168 (lexicon) OST114931 (lexicon) OST95191 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000699935 (Chr2:20665086..20666443 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CACGCAGATAGCAGATGGAA Chr2:20666208..20666227 59.97 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000699935 (Chr2:20665086..20666443 +)
Downstram Exon
ENSMUSE00000712334 (Chr2:20665086..20665918 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CACGCAGATAGCAGATGGAA Chr2:20666208..20666227 59.97 50 TGTCTTCATCCGGTTTGACA Chr2:20665377..20665396 60.09 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000699940 Chr2:19831407..19831906 CTCTTGCCACCGAAAGACTC Chr2:19831746..19831765 59.99 55
upstream ENSMUSE00000699939 Chr2:20038600..20038680 CTGGACCCTGTGTTTGACATC Chr2:20038610..20038630 60.42 52.38
upstream ENSMUSE00000699938 Chr2:20211521..20211668 AAAGTCGCCCTCAAAGGATT Chr2:20211603..20211622 60.07 45
upstream ENSMUSE00000699998 Chr2:20211540..20211668 AAAGTCGCCCTCAAAGGATT Chr2:20211603..20211622 60.07 45
upstream ENSMUSE00000699971 Chr2:20261523..20261736 AGAAGAAAACCAGCCGAGGT Chr2:20261614..20261633 60.25 50
upstream ENSMUSE00000699995 Chr2:20261549..20261736 AGAAGAAAACCAGCCGAGGT Chr2:20261614..20261633 60.25 50
upstream ENSMUSE00000410886 Chr2:20431674..20431886 TTGGCAACCTGAAGAACACA Chr2:20431841..20431860 60.28 45
upstream ENSMUSE00000708489 Chr2:20441140..20441554 AGAAATGTGAGCCGAACCTG Chr2:20441504..20441523 60.26 50
upstream ENSMUSE00000717316 Chr2:20441140..20441554 AGAAATGTGAGCCGAACCTG Chr2:20441504..20441523 60.26 50
upstream ENSMUSE00000721391 Chr2:20441140..20441554 AGAAATGTGAGCCGAACCTG Chr2:20441504..20441523 60.26 50
upstream ENSMUSE00000647336 Chr2:20441455..20441554 AGAAATGTGAGCCGAACCTG Chr2:20441504..20441523 60.26 50
upstream ENSMUSE00000423589 Chr2:20451586..20451869 CAGGGAACGCCTTTCTAATG Chr2:20451644..20451663 59.7 50
upstream ENSMUSE00000715347 Chr2:20451586..20451869 CAGGGAACGCCTTTCTAATG Chr2:20451644..20451663 59.7 50
upstream ENSMUSE00000716425 Chr2:20451586..20451869 CAGGGAACGCCTTTCTAATG Chr2:20451644..20451663 59.7 50
upstream ENSMUSE00000699932 Chr2:20583525..20583723 CCATGTCCGAGGGAGAAGTA Chr2:20583619..20583638 60.06 55
upstream ENSMUSE00000713171 Chr2:20583525..20583723 CCATGTCCGAGGGAGAAGTA Chr2:20583619..20583638 60.06 55
upstream ENSMUSE00000717687 Chr2:20583525..20583723 CCATGTCCGAGGGAGAAGTA Chr2:20583619..20583638 60.06 55
upstream ENSMUSE00000410192 Chr2:20631032..20631230 CTCTTCGTCAGTGCCTTTCC Chr2:20631115..20631134 59.99 55
upstream ENSMUSE00000699967 Chr2:20631032..20631230 CTCTTCGTCAGTGCCTTTCC Chr2:20631115..20631134 59.99 55
upstream ENSMUSE00000272760 Chr2:20634982..20635075 No primer for this exon
upstream ENSMUSE00000699966 Chr2:20634982..20635075 No primer for this exon
upstream ENSMUSE00000699927 Chr2:20644252..20644350 AGGTCTCTGCGAGTCTGGAA Chr2:20644292..20644311 60.13 55
upstream ENSMUSE00000699929 Chr2:20658941..20659182 GAAGACCGGGTCAAAACAAA Chr2:20658963..20658982 59.95 45

*** Putative Vector Insertion (Chr 2: 20665085 - 20665919) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000647337 Chr2:20665086..20665918 TGTCTTCATCCGGTTTGACA Chr2:20665377..20665396 60.09 45
downstream ENSMUSE00000699935 Chr2:20665086..20666443 ACCTGAACCCACTCATCCAG Chr2:20666064..20666083 59.96 55
downstream ENSMUSE00000709622 Chr2:20665086..20665918 TGTCTTCATCCGGTTTGACA Chr2:20665377..20665396 60.09 45
downstream ENSMUSE00000712334 Chr2:20665086..20665918 TGTCTTCATCCGGTTTGACA Chr2:20665377..20665396 60.09 45
downstream ENSMUSE00000647335 Chr2:20681174..20681278 CTGGCAATCTGCTTCTCCAT Chr2:20681212..20681231 60.36 50
downstream ENSMUSE00000423086 Chr2:20681842..20681891 GCTGTGGCTTTCACCATTTT Chr2:20681868..20681887 60.12 45
downstream ENSMUSE00000699964 Chr2:20681842..20681891 GCTGTGGCTTTCACCATTTT Chr2:20681868..20681887 60.12 45
downstream ENSMUSE00000423066 Chr2:20688072..20688238 TGTCAAGCAGGCTAGTGTGG Chr2:20688185..20688204 60.05 55
downstream ENSMUSE00000699963 Chr2:20688072..20688238 TGTCAAGCAGGCTAGTGTGG Chr2:20688185..20688204 60.05 55
downstream ENSMUSE00000699924 Chr2:20688199..20688238 TGGAGTTGGAGCCTGAGTTC Chr2:20688222..20688241 60.39 55
downstream ENSMUSE00000423064 Chr2:20699653..20699828 ACAATCCGCTCTTCTTCGTG Chr2:20699819..20699838 60.4 50
downstream ENSMUSE00000699962 Chr2:20699653..20699828 ACAATCCGCTCTTCTTCGTG Chr2:20699819..20699838 60.4 50
downstream ENSMUSE00000423061 Chr2:20702569..20702699 ACTCTGCCAGTGGAGGAAGA Chr2:20702628..20702647 59.99 55
downstream ENSMUSE00000699959 Chr2:20702569..20702699 ACTCTGCCAGTGGAGGAAGA Chr2:20702628..20702647 59.99 55
downstream ENSMUSE00000423058 Chr2:20703425..20703572 CAACTTCTATGCGCAGGACA Chr2:20703481..20703500 60.01 50
downstream ENSMUSE00000699958 Chr2:20703425..20703572 CAACTTCTATGCGCAGGACA Chr2:20703481..20703500 60.01 50
downstream ENSMUSE00000383856 Chr2:20706671..20707127 ACCATTCACTGGGGTCTGAG Chr2:20707058..20707077 59.96 55
downstream ENSMUSE00000699923 Chr2:20706671..20707127 ACCATTCACTGGGGTCTGAG Chr2:20707058..20707077 59.96 55
downstream ENSMUSE00000699944 Chr2:20706671..20707094 ACCATTCACTGGGGTCTGAG Chr2:20707058..20707077 59.96 55
downstream ENSMUSE00000699957 Chr2:20706671..20706862 GATAGGGGCACCACTTCTGA Chr2:20706859..20706878 60.07 55
downstream ENSMUSE00000272689 Chr2:20710055..20710238 GCATCTCCCTTTGACACTGG Chr2:20710215..20710234 60.66 55
downstream ENSMUSE00000699919 Chr2:20710055..20710238 GCATCTCCCTTTGACACTGG Chr2:20710215..20710234 60.66 55
downstream ENSMUSE00000272683 Chr2:20719504..20719658 AGACCACATCGCCTGATCTC Chr2:20719638..20719657 60.23 55
downstream ENSMUSE00000647334 Chr2:20719504..20719658 AGACCACATCGCCTGATCTC Chr2:20719638..20719657 60.23 55
downstream ENSMUSE00000343104 Chr2:20720243..20720410 GGGGACATTTTGTGGCTCTA Chr2:20720300..20720319 59.93 50
downstream ENSMUSE00000521501 Chr2:20723169..20723288 CTGTTAGCTCGGGACTGCTC Chr2:20723239..20723258 60.16 60
downstream ENSMUSE00000647331 Chr2:20727212..20727289 GGGCCATTTTCACATTCAAC Chr2:20727273..20727292 60.18 45
downstream ENSMUSE00000647330 Chr2:20727402..20729000 TCGGACTCCAGAGTCTTCGT Chr2:20728283..20728302 59.99 55
downstream ENSMUSE00000345647 Chr2:20729529..20729651 CCTGTAGTTTGGACTGCTTGC Chr2:20729633..20729653 59.93 52.38
downstream ENSMUSE00000699925 Chr2:20729529..20731981 CTGGCGAGGCTAGGAGTATG Chr2:20730776..20730795 59.99 60
downstream ENSMUSE00000699926 Chr2:20729529..20729817 CCTGTAGTTTGGACTGCTTGC Chr2:20729633..20729653 59.93 52.38
downstream ENSMUSE00000699956 Chr2:20729573..20729651 CCTGTAGTTTGGACTGCTTGC Chr2:20729633..20729653 59.93 52.38
downstream ENSMUSE00000391727 Chr2:20730337..20732151 GCTTGCGCTAGCGAATTATC Chr2:20731513..20731532 60.11 50
downstream ENSMUSE00000647329 Chr2:20730337..20731980 GCTTGCGCTAGCGAATTATC Chr2:20731513..20731532 60.11 50
downstream ENSMUSE00000699928 Chr2:20730337..20732340 GCTTGCGCTAGCGAATTATC Chr2:20731513..20731532 60.11 50
downstream ENSMUSE00000699942 Chr2:20730337..20732163 GCTTGCGCTAGCGAATTATC Chr2:20731513..20731532 60.11 50
downstream ENSMUSE00000699954 Chr2:20730337..20732151 GCTTGCGCTAGCGAATTATC Chr2:20731513..20731532 60.11 50
downstream ENSMUSE00000699974 Chr2:20730337..20732162 GCTTGCGCTAGCGAATTATC Chr2:20731513..20731532 60.11 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAAGAGGAGATGGGCTTGTT Chr2:20665109..20665129 59.28 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAAGAGGAGATGGGCTTGTT Chr2:20665109..20665129 59.28 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000036617