Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI21129
Trapped Gene
Alas1 (ENSMUSG00000032786)
Vector Insertion
Chr 9: 106143670 - 106143966
Public Clones not available
Private Clones OST340538 (lexicon)
Severity of mutation (?) Insertion after 30% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000343550 (Chr9:106143967..106144116 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTGAAAACCGATGGAGAGGA Chr9:106144059..106144078 60.05 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000343550 (Chr9:106143967..106144116 -)
Downstram Exon
ENSMUSE00000336468 (Chr9:106143447..106143669 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTGAAAACCGATGGAGAGGA Chr9:106144059..106144078 60.05 50 CTCTCCGGTTCACCGTTTTA Chr9:106143549..106143568 60.1 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000530318 Chr9:106150116..106150187 AAGGGCACTGGTCGGTTTAG Chr9:106150164..106150183 61.41 55
upstream ENSMUSE00000692003 Chr9:106149505..106150061 CTGTAGGGGCATGACCTTGT Chr9:106149752..106149771 59.99 55
upstream ENSMUSE00000350363 Chr9:106149090..106149309 AAAACTGCCCCAAGATGATG Chr9:106149178..106149197 59.93 45
upstream ENSMUSE00000477628 Chr9:106145493..106145726 AGTCCCAGATGGCACAGACT Chr9:106145665..106145684 59.71 55
upstream ENSMUSE00000343550 Chr9:106143967..106144116 GTGAAAACCGATGGAGAGGA Chr9:106144059..106144078 60.05 50

*** Putative Vector Insertion (Chr 9: 106143670 - 106143966) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000336468 Chr9:106143447..106143669 CTCTCCGGTTCACCGTTTTA Chr9:106143549..106143568 60.1 50
downstream ENSMUSE00000530313 Chr9:106141863..106142047 ATTCCTAGTTCCCCCAGCTC Chr9:106141980..106141999 59.54 55
downstream ENSMUSE00000530311 Chr9:106140974..106141153 GGTTCCCGGAATCAGAGTAA Chr9:106141102..106141121 58.98 50
downstream ENSMUSE00000530309 Chr9:106140406..106140570 AAGCGTCCCAGAGATGATGT Chr9:106140385..106140404 59.69 50
downstream ENSMUSE00000691977 Chr9:106140406..106140567 AAGCGTCCCAGAGATGATGT Chr9:106140385..106140404 59.69 50
downstream ENSMUSE00000262922 Chr9:106138771..106139039 AAGCTTGACATTTCGCTGGT Chr9:106138818..106138837 59.88 45
downstream ENSMUSE00000262900 Chr9:106137719..106137881 AATTGATGGCCTGGACGTAG Chr9:106137781..106137800 59.96 50
downstream ENSMUSE00000399108 Chr9:106136262..106136528 CAGCTGACGAATGTGGCTTA Chr9:106136447..106136466 60.01 50
downstream ENSMUSE00000691978 Chr9:106135794..106136528 CAGCTGACGAATGTGGCTTA Chr9:106136447..106136466 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTGGGAGTCTGTGTGTCAGG Chr9:106143932..106143952 59.71 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTGGGAGTCTGTGTGTCAGG Chr9:106143932..106143952 59.71 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032786